Transcript: Human XM_017029894.2

PREDICTED: Homo sapiens transmembrane protein 164 (TMEM164), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM164 (84187)
Length:
5341
CDS:
468..1004

Additional Resources:

NCBI RefSeq record:
XM_017029894.2
NBCI Gene record:
TMEM164 (84187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248887 CCTGGTCACCGAAGTGAATTT pLKO_005 794 CDS 100% 13.200 9.240 N Tmem164 n/a
2 TRCN0000122719 CCCATCTACCTGCTTTGGAAA pLKO.1 672 CDS 100% 4.950 3.465 N TMEM164 n/a
3 TRCN0000322570 CCCATCTACCTGCTTTGGAAA pLKO_005 672 CDS 100% 4.950 3.465 N TMEM164 n/a
4 TRCN0000144118 CCGAAGTGAATTTGAACAACA pLKO.1 802 CDS 100% 4.950 3.465 N TMEM164 n/a
5 TRCN0000322572 CCGAAGTGAATTTGAACAACA pLKO_005 802 CDS 100% 4.950 3.465 N TMEM164 n/a
6 TRCN0000141034 CTCAACTGGCCTCATGTTCTT pLKO.1 743 CDS 100% 4.950 3.465 N TMEM164 n/a
7 TRCN0000322642 CTCAACTGGCCTCATGTTCTT pLKO_005 743 CDS 100% 4.950 3.465 N TMEM164 n/a
8 TRCN0000142465 GCTGGTCATCCTGTTCTCATA pLKO.1 917 CDS 100% 4.950 3.465 N TMEM164 n/a
9 TRCN0000144275 CATTCAGCATGTTATGCTCTA pLKO.1 644 CDS 100% 4.050 2.835 N TMEM164 n/a
10 TRCN0000142197 GCTTCCCTTAGAACCAGTCTT pLKO.1 5002 3UTR 100% 4.950 2.475 Y TMEM164 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04340 pDONR223 100% 58.8% 56.5% None (many diffs) n/a
2 ccsbBroad304_04340 pLX_304 0% 58.8% 56.5% V5 (many diffs) n/a
3 TRCN0000477463 TTTGTTTTACTGATTTTTACTAAT pLX_317 47.3% 58.8% 56.5% V5 (many diffs) n/a
Download CSV