Construct: ORF TRCN0000477463
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002725.1_s317c1
- Derived from:
- ccsbBroadEn_04340
- DNA Barcode:
- TTTGTTTTACTGATTTTTACTAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM164 (84187)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477463
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84187 | TMEM164 | transmembrane protein 164 | NM_001353849.2 | 100% | 100% | |
2 | human | 84187 | TMEM164 | transmembrane protein 164 | NM_032227.4 | 100% | 100% | |
3 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_005262205.4 | 100% | 100% | |
4 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_005262208.5 | 61.6% | 53.6% | (many diffs) |
5 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_017029894.2 | 58.8% | 56.5% | (many diffs) |
6 | human | 84187 | TMEM164 | transmembrane protein 164 | NM_001353850.2 | 57.2% | 57.2% | 0_1ins381 |
7 | human | 84187 | TMEM164 | transmembrane protein 164 | NM_001353851.1 | 57.2% | 57.2% | 0_1ins381 |
8 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_017029899.1 | 57.2% | 57.2% | 0_1ins381 |
9 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_017029897.1 | 56.5% | 56.2% | 0_1ins384;3_4insCAT |
10 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_017029895.1 | 53.2% | 42.7% | (many diffs) |
11 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_017029898.1 | 52.1% | 42.8% | 390_391ins50;465_466ins376 |
12 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_017029900.1 | 50.7% | 50.5% | 0_1ins438;2T>A |
13 | human | 84187 | TMEM164 | transmembrane protein 164 | NM_017698.2 | 49.8% | 49.8% | 0_1ins447 |
14 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_011531054.1 | 49.8% | 49.8% | 0_1ins447 |
15 | human | 84187 | TMEM164 | transmembrane protein 164 | XM_011531055.2 | 49.8% | 49.8% | 0_1ins447 |
16 | mouse | 209497 | Tmem164 | transmembrane protein 164 | NM_001199360.1 | 95.6% | 94.9% | (many diffs) |
17 | mouse | 209497 | Tmem164 | transmembrane protein 164 | NM_177592.4 | 95.6% | 94.9% | (many diffs) |
18 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_006528779.1 | 83.7% | 82.8% | (many diffs) |
19 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_006528780.1 | 82.6% | 73.8% | (many diffs) |
20 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_006528781.1 | 65.7% | 57.3% | (many diffs) |
21 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_011247804.1 | 57.6% | 52.6% | (many diffs) |
22 | mouse | 209497 | Tmem164 | transmembrane protein 164 | NM_001199357.1 | 47.6% | 47.8% | (many diffs) |
23 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_006528783.3 | 47.6% | 47.8% | (many diffs) |
24 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_006528784.2 | 47.6% | 47.8% | (many diffs) |
25 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_006528785.1 | 47.6% | 47.8% | (many diffs) |
26 | mouse | 209497 | Tmem164 | transmembrane protein 164 | XM_006528786.3 | 47.6% | 47.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 960
- ORF length:
- 891
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcccggtat agctaccaga gtctcctgga ctggctctat gggggcgtgg 121 accccagttt tgcaggcaat gggggccccg actgtgctgc cttcctctct tggcagcagc 181 ggctgctgga aagtgtggtg gtcctgaccc tggctctgtt ggagatcctg gtggccctgc 241 ggcacatcct gaggcagacg aaggaggacg gtaggggtag ccctggcagc cagccagagc 301 aggtgaccca gcggccagag gaaggcaagg agagcctgag caagaatctg ctcttagtag 361 ccctgtgcct gaccttcggg gtggaggtgg gctttaagtt cgccaccaag accgtcatct 421 acctgctcaa cccctgtcac ctggtcacca tgatgcatat ctttctcctg gcctgccctc 481 catgtcgggg agctatcgtc gtcttcaagc tacagatgca catgttgaat ggagctcTTC 541 TGGCATTGCT GTTTCCTGTG GTAAACACTC GGCTGCTCCC CTTTGAATTG GAGATTTACT 601 ACATTCAGCA TGTTATGCTC TACGTGGTAC CCATCTACCT GCTTTGGAAA GGAGGTGCTT 661 ACACTCCAGA GCCCCTCAGC AGTTTCCGGT GGGCTCTTCT CTCAACTGGC CTCATGTTCT 721 TTTATCACTT CAGCGTCTTG CAGATCCTCG GCCTGGTCAC CGAAGTGAAT TTGAACAACA 781 TGCTGTGTCC GGCCATCTCA GACCCATTCT ACGGCCCCTG GTATCGCATC TGGGCCTCGG 841 GACACCAGAC TCTCATGACC ATGACCCACG GGAAGCTGGT CATCCTGTTC TCATACATGG 901 CTGGGCCCTT GTGTAAATAT CTGCTGGATT TGCTCCGGCT TCCAGCCAAG AAAATAGACT 961 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1021 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1081 TTTATATATC TTGTGGAAAG GACGATTTGT TTTACTGATT TTTACTAATA CGCGTTAAGT 1141 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt