Transcript: Human XM_017029926.2

PREDICTED: Homo sapiens adaptor related protein complex 1 subunit sigma 2 (AP1S2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP1S2 (8905)
Length:
1071
CDS:
154..723

Additional Resources:

NCBI RefSeq record:
XM_017029926.2
NBCI Gene record:
AP1S2 (8905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059456 CCCACTATCAGACAAAGAGAA pLKO.1 339 CDS 100% 4.950 2.970 N AP1S2 n/a
2 TRCN0000333442 CCCACTATCAGACAAAGAGAA pLKO_005 339 CDS 100% 4.950 2.970 N AP1S2 n/a
3 TRCN0000059457 GCGAGATCTGAAGATTGTTTA pLKO.1 432 CDS 100% 13.200 6.600 Y AP1S2 n/a
4 TRCN0000333505 GCGAGATCTGAAGATTGTTTA pLKO_005 432 CDS 100% 13.200 6.600 Y AP1S2 n/a
5 TRCN0000313402 CTATTGAGGATCAGGACAATG pLKO_005 485 CDS 100% 10.800 5.400 Y Ap1s2 n/a
6 TRCN0000059455 GCAGTGTCTGTGAACTAGATA pLKO.1 563 CDS 100% 5.625 2.813 Y AP1S2 n/a
7 TRCN0000333506 GCAGTGTCTGTGAACTAGATA pLKO_005 563 CDS 100% 5.625 2.813 Y AP1S2 n/a
8 TRCN0000059453 CCTGGAAATAATTCATCGTTA pLKO.1 516 CDS 100% 4.950 2.475 Y AP1S2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02047 pDONR223 100% 73.3% 71.3% None (many diffs) n/a
2 ccsbBroad304_02047 pLX_304 0% 73.3% 71.3% V5 (many diffs) n/a
3 TRCN0000473696 CCATGTTTTGTACAACTTATCTTT pLX_317 86.3% 73.3% 71.3% V5 (many diffs) n/a
Download CSV