Transcript: Mouse XM_017312269.1

PREDICTED: Mus musculus NSE1 homolog, SMC5-SMC6 complex component (Nsmce1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nsmce1 (67711)
Length:
948
CDS:
28..828

Additional Resources:

NCBI RefSeq record:
XM_017312269.1
NBCI Gene record:
Nsmce1 (67711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277166 AGAACGAGCTGGATCTGTTTA pLKO_005 335 CDS 100% 13.200 9.240 N Nsmce1 n/a
2 TRCN0000191374 CTTTGCTTCTTCTACAAACAT pLKO.1 393 CDS 100% 5.625 3.938 N Nsmce1 n/a
3 TRCN0000277163 CTTTGCTTCTTCTACAAACAT pLKO_005 393 CDS 100% 5.625 3.938 N Nsmce1 n/a
4 TRCN0000190874 CCCATTTATGCACTGGTGAAT pLKO.1 271 CDS 100% 4.950 3.465 N Nsmce1 n/a
5 TRCN0000277165 CCCATTTATGCACTGGTGAAT pLKO_005 271 CDS 100% 4.950 3.465 N Nsmce1 n/a
6 TRCN0000200673 GAGTCTCTGTATATTGAGATA pLKO.1 220 CDS 100% 4.950 3.465 N Nsmce1 n/a
7 TRCN0000277164 GAGTCTCTGTATATTGAGATA pLKO_005 220 CDS 100% 4.950 3.465 N Nsmce1 n/a
8 TRCN0000073230 TGGTGAATCTTGCTACAACTT pLKO.1 284 CDS 100% 4.950 3.465 N NSMCE1 n/a
9 TRCN0000190023 GCAGAAGTTTGTGCAGAGCAA pLKO.1 477 CDS 100% 2.640 1.848 N Nsmce1 n/a
10 TRCN0000277167 TACCAGGTCCATGACCGAAAT pLKO_005 148 CDS 100% 0.000 0.000 N Nsmce1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13377 pDONR223 100% 82.9% 86% None (many diffs) n/a
2 ccsbBroad304_13377 pLX_304 0% 82.9% 86% V5 (many diffs) n/a
3 TRCN0000469879 GTGTATAACTTGATTCATGGCTCC pLX_317 55.9% 82.9% 86% V5 (many diffs) n/a
Download CSV