Transcript: Mouse XM_017312530.1

PREDICTED: Mus musculus N-acylsphingosine amidohydrolase 1 (Asah1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asah1 (11886)
Length:
3711
CDS:
1579..2763

Additional Resources:

NCBI RefSeq record:
XM_017312530.1
NBCI Gene record:
Asah1 (11886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377046 GATGTTACCAAAGGTCAATTT pLKO_005 2698 CDS 100% 13.200 18.480 N Asah1 n/a
2 TRCN0000377106 CCATGTGTACATCAATCATAA pLKO_005 1997 CDS 100% 13.200 9.240 N Asah1 n/a
3 TRCN0000101471 CCGGCCAAGAAGTGTCTAAAT pLKO.1 2581 CDS 100% 13.200 9.240 N Asah1 n/a
4 TRCN0000101472 GCACACCATAAATCTTGATTT pLKO.1 1722 CDS 100% 13.200 9.240 N Asah1 n/a
5 TRCN0000363556 GCACACCATAAATCTTGATTT pLKO_005 1722 CDS 100% 13.200 9.240 N Asah1 n/a
6 TRCN0000101470 CCTCATCATGTTACATTGTTT pLKO.1 2882 3UTR 100% 5.625 3.938 N Asah1 n/a
7 TRCN0000327347 CCTCATCATGTTACATTGTTT pLKO_005 2882 3UTR 100% 5.625 3.938 N Asah1 n/a
8 TRCN0000101473 CTACCATCTATGATGTCCTAT pLKO.1 2630 CDS 100% 4.950 3.465 N Asah1 n/a
9 TRCN0000101474 CGTGGACAGAAGATTGCAGAA pLKO.1 1652 CDS 100% 4.050 2.835 N Asah1 n/a
10 TRCN0000327434 CGTGGACAGAAGATTGCAGAA pLKO_005 1652 CDS 100% 4.050 2.835 N Asah1 n/a
11 TRCN0000123436 CCAAATTGAAAGCTGACCGAT pLKO.1 6 5UTR 100% 2.640 1.320 Y Frg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.