Transcript: Mouse XM_017312699.1

PREDICTED: Mus musculus alcohol dehydrogenase, iron containing, 1 (Adhfe1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adhfe1 (76187)
Length:
2368
CDS:
474..1733

Additional Resources:

NCBI RefSeq record:
XM_017312699.1
NBCI Gene record:
Adhfe1 (76187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424958 TGGATTCCCTATCGAAGAATG pLKO_005 610 CDS 100% 10.800 15.120 N Adhfe1 n/a
2 TRCN0000220911 CCCAATTTCAGGTTTAGTGAA pLKO.1 1331 CDS 100% 4.950 6.930 N ADHFE1 n/a
3 TRCN0000412359 CCATGAAACTGTACTAATTAA pLKO_005 1717 CDS 100% 15.000 10.500 N Adhfe1 n/a
4 TRCN0000041290 CCAGTAACTGTGCCTCTTAAA pLKO.1 846 CDS 100% 13.200 9.240 N Adhfe1 n/a
5 TRCN0000041288 CCGTCTTATCTCCACACTTAA pLKO.1 1815 3UTR 100% 13.200 9.240 N Adhfe1 n/a
6 TRCN0000427555 GGTTTGAATGTGATGTGATTT pLKO_005 1849 3UTR 100% 13.200 9.240 N Adhfe1 n/a
7 TRCN0000428899 TGGCATGTCTTACCCAATTTC pLKO_005 1319 CDS 100% 13.200 9.240 N Adhfe1 n/a
8 TRCN0000041292 CCTCACTCTGAGTTCCTTGAT pLKO.1 795 CDS 100% 4.950 3.465 N Adhfe1 n/a
9 TRCN0000041289 GCCAAGGAATATAATGTGGAT pLKO.1 1362 CDS 100% 2.640 1.848 N Adhfe1 n/a
10 TRCN0000041291 GCTCTTGGTTATTCCAAGGAT pLKO.1 1593 CDS 100% 0.300 0.210 N Adhfe1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.