Transcript: Mouse XM_017312701.1

PREDICTED: Mus musculus pleckstrin and Sec7 domain containing 3 (Psd3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psd3 (234353)
Length:
12326
CDS:
571..4437

Additional Resources:

NCBI RefSeq record:
XM_017312701.1
NBCI Gene record:
Psd3 (234353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295607 CATCGGTCCCAGATAACTAAT pLKO_005 1993 CDS 100% 13.200 18.480 N Psd3 n/a
2 TRCN0000295662 TTCGGAACCGGATAGCTATTT pLKO_005 2679 CDS 100% 13.200 18.480 N Psd3 n/a
3 TRCN0000110077 GCCGAACGTGTTTAAACTCAA pLKO.1 3876 CDS 100% 4.950 6.930 N Psd3 n/a
4 TRCN0000298437 GCCGAACGTGTTTAAACTCAA pLKO_005 3876 CDS 100% 4.950 6.930 N Psd3 n/a
5 TRCN0000295661 TTTCTGGTAATCCGTGAATAT pLKO_005 4495 3UTR 100% 13.200 10.560 N Psd3 n/a
6 TRCN0000110076 CCAAAGACTATCAGTCGTATT pLKO.1 3574 CDS 100% 10.800 8.640 N Psd3 n/a
7 TRCN0000110078 CTGATGAGAAGGCTAATGGAA pLKO.1 3548 CDS 100% 3.000 2.100 N Psd3 n/a
8 TRCN0000288400 CTGATGAGAAGGCTAATGGAA pLKO_005 3548 CDS 100% 3.000 2.100 N Psd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.