Transcript: Mouse XM_017312858.1

PREDICTED: Mus musculus zinc finger, matrin type 4 (Zmat4), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zmat4 (320158)
Length:
4098
CDS:
53..742

Additional Resources:

NCBI RefSeq record:
XM_017312858.1
NBCI Gene record:
Zmat4 (320158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181779 GCCTCCTGTTAAATCGAGATA pLKO.1 3102 3UTR 100% 4.950 6.930 N Zmat4 n/a
2 TRCN0000181482 CCCTATCAAAGAAGAGACTCA pLKO.1 461 CDS 100% 2.640 3.696 N Zmat4 n/a
3 TRCN0000440217 GGTCGCATCTCCCTATCAAAG pLKO_005 451 CDS 100% 10.800 8.640 N ZMAT4 n/a
4 TRCN0000429974 TGTGGTCTGTAGAAGTTATAT pLKO_005 1208 3UTR 100% 15.000 10.500 N Zmat4 n/a
5 TRCN0000420805 TAAGCCTCCTAGATCCATTAA pLKO_005 1123 3UTR 100% 13.200 9.240 N Zmat4 n/a
6 TRCN0000413435 AGCATTACGAAGGCAAGAAAC pLKO_005 537 CDS 100% 10.800 7.560 N Zmat4 n/a
7 TRCN0000182562 GAGAGGTCTGAGACGTACTTA pLKO.1 625 CDS 100% 5.625 3.938 N Zmat4 n/a
8 TRCN0000182666 GTGTCGCTCAACTCCATAGAA pLKO.1 665 CDS 100% 5.625 3.938 N Zmat4 n/a
9 TRCN0000178651 CTCAACTCCATAGAACAGTAT pLKO.1 671 CDS 100% 4.950 3.465 N Zmat4 n/a
10 TRCN0000198542 GCCAGATCATAGCTTAGGAAA pLKO.1 1391 3UTR 100% 4.950 3.465 N Zmat4 n/a
11 TRCN0000181256 CAGTATCATGCACATCTGCAA pLKO.1 686 CDS 100% 2.640 1.848 N Zmat4 n/a
12 TRCN0000177217 GTGGATAAGAATAAATGCTGT pLKO.1 263 CDS 100% 2.640 1.848 N Zmat4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08947 pDONR223 100% 59.5% 64.1% None (many diffs) n/a
2 ccsbBroad304_08947 pLX_304 0% 59.5% 64.1% V5 (many diffs) n/a
3 TRCN0000465243 CTTGCTTCCATTTGGCCACTCGGC pLX_317 24.6% 59.4% 63.7% V5 (many diffs) n/a
Download CSV