Construct: ORF TRCN0000465243
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018360.1_s317c1
- Derived from:
- ccsbBroadEn_08947
- DNA Barcode:
- CTTGCTTCCATTTGGCCACTCGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZMAT4 (79698)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465243
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | NM_001135731.2 | 99.5% | 98.6% | 373A>G;442A>C |
2 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | NM_024645.3 | 66.5% | 65.9% | 348_575del;601A>G;670A>C |
3 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | XM_017013836.2 | 57.3% | 52.6% | (many diffs) |
4 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | XM_024447276.1 | 46.4% | 45.8% | (many diffs) |
5 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | XM_024447277.1 | 46.4% | 45.8% | (many diffs) |
6 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | XM_017013837.2 | 38.7% | 33.6% | (many diffs) |
7 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | XM_017013838.2 | 38.7% | 33.6% | (many diffs) |
8 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | XM_024447275.1 | 38.7% | 33.6% | (many diffs) |
9 | human | 79698 | ZMAT4 | zinc finger matrin-type 4 | XM_017013840.1 | 29.4% | 24% | (many diffs) |
10 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | NM_177086.4 | 59.4% | 63.7% | (many diffs) |
11 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | XM_006509140.3 | 59.4% | 63.7% | (many diffs) |
12 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | XM_006509141.2 | 59.4% | 63.7% | (many diffs) |
13 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | XM_011242141.2 | 59.4% | 63.7% | (many diffs) |
14 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | XM_011242142.2 | 59.4% | 63.7% | (many diffs) |
15 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | XM_017312858.1 | 59.4% | 63.7% | (many diffs) |
16 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | XM_006509139.3 | 56% | 60% | (many diffs) |
17 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | XM_006509142.3 | 41.2% | 43.6% | (many diffs) |
18 | mouse | 320158 | Zmat4 | zinc finger, matrin type 4 | NM_001277239.1 | 31.9% | 34% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 525
- ORF length:
- 459
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gtcctccgat attgatcagg atttattcac agacagttac tgcaaggtgt 121 gcagtgcaca gctgatctcc gaatcgcagc gtgtggccca ctacgagagt cgaaaacatg 181 caagcaaagt ccgactgtat tacatgcttc accccaggga tggagggtgt cctgccaaga 241 ggctccggtc agaaaatgga agtgatgccg acatggtgga taagaacaag tgctgcacac 301 tctgcaacat gtcattcact tcagcggtgg tggccgattc ccattatcaa ggcaaaatcc 361 acgccaagag gttaaaactc ttgctaggag agaagacccc attaaagacc acaggtcTGA 421 GGCGCAATTA CAGATGTGCC ATCTGCAGTG TCTCCCTAAA CTCAATAGAA CAGTATCATG 481 CCCATCTGAA AGGATCTAAA CACCAGCCCA ACCTGAAGAA TAAGTACCCA ACTTTCTTGT 541 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 601 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 661 GAAAGGACGA CTTGCTTCCA TTTGGCCACT CGGCACGCGT TAAGTCgaca atcaacctct 721 ggattacaaa atttgtgaaa gatt