Transcript: Mouse XM_017312910.1

PREDICTED: Mus musculus microtubule associated serine/threonine kinase 3 (Mast3), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mast3 (546071)
Length:
5284
CDS:
16..3987

Additional Resources:

NCBI RefSeq record:
XM_017312910.1
NBCI Gene record:
Mast3 (546071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367266 CAAGCCCTCGCGACTAATTTA pLKO_005 4132 3UTR 100% 15.000 21.000 N Mast3 n/a
2 TRCN0000022974 GTGCAGGAGGTGAGCTTCGAT pLKO.1 3874 CDS 100% 1.000 0.800 N Mast3 n/a
3 TRCN0000367267 TCTGGTCACTTCCCGCTATTT pLKO_005 783 CDS 100% 13.200 9.240 N Mast3 n/a
4 TRCN0000022976 TCGGGATTCCTTCAAGAAGCA pLKO.1 3846 CDS 100% 2.640 1.848 N Mast3 n/a
5 TRCN0000022975 CCCAGGACATGCCAGGAAAGA pLKO.1 3963 CDS 100% 1.650 1.155 N Mast3 n/a
6 TRCN0000022978 GTGAGCTTCGATGAGGAGCCT pLKO.1 3883 CDS 100% 0.220 0.154 N Mast3 n/a
7 TRCN0000197052 GCGACTTTGAGACCATCAAAC pLKO.1 1181 CDS 100% 1.080 0.864 N MAST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489717 TTTCATTAGAAACCTGAATTGTAC pLX_317 17.5% 41.8% 44.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491941 ATCCCACGGCATTCTGCCTCAGCT pLX_317 21.1% 41.8% 44.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV