Transcript: Mouse XM_017313021.1

PREDICTED: Mus musculus Rho GTPase activating protein 10 (Arhgap10), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap10 (78514)
Length:
3376
CDS:
1107..3005

Additional Resources:

NCBI RefSeq record:
XM_017313021.1
NBCI Gene record:
Arhgap10 (78514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094796 CCGAGTTAATGCCATCCACTT pLKO.1 2267 CDS 100% 4.050 5.670 N Arhgap10 n/a
2 TRCN0000335117 CCGAGTTAATGCCATCCACTT pLKO_005 2267 CDS 100% 4.050 5.670 N Arhgap10 n/a
3 TRCN0000433233 GAGTATGTTGATGGATGTAAA pLKO_005 2087 CDS 100% 13.200 9.240 N ARHGAP10 n/a
4 TRCN0000094795 GCCATCATGGATTTGAAGTTT pLKO.1 2451 CDS 100% 5.625 3.938 N Arhgap10 n/a
5 TRCN0000335195 GCCATCATGGATTTGAAGTTT pLKO_005 2451 CDS 100% 5.625 3.938 N Arhgap10 n/a
6 TRCN0000094797 GCCGTGTACAACCTTTGTCTT pLKO.1 2631 CDS 100% 4.950 3.465 N Arhgap10 n/a
7 TRCN0000335196 GCCGTGTACAACCTTTGTCTT pLKO_005 2631 CDS 100% 4.950 3.465 N Arhgap10 n/a
8 TRCN0000094798 AGAAAGAAAGAAGTTCGAGTT pLKO.1 1364 CDS 100% 4.050 2.835 N Arhgap10 n/a
9 TRCN0000335194 AGAAAGAAAGAAGTTCGAGTT pLKO_005 1364 CDS 100% 4.050 2.835 N Arhgap10 n/a
10 TRCN0000094794 GCTGTCCTTCTTTCAGGGAAT pLKO.1 1397 CDS 100% 4.050 2.835 N Arhgap10 n/a
11 TRCN0000048475 GCCTCTCATGACCTATGAGTT pLKO.1 2201 CDS 100% 0.495 0.347 N ARHGAP10 n/a
12 TRCN0000430704 CAGAACACAGCTCGGAATTAT pLKO_005 2866 CDS 100% 15.000 10.500 N ARHGAP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.