Transcript: Mouse XM_017313152.1

PREDICTED: Mus musculus interleukin enhancer binding factor 3 (Ilf3), transcript variant X28, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ilf3 (16201)
Length:
3026
CDS:
877..2568

Additional Resources:

NCBI RefSeq record:
XM_017313152.1
NBCI Gene record:
Ilf3 (16201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066794 GCATGGCAAGAACCCTGTTAT pLKO.1 1440 CDS 100% 13.200 18.480 N Ilf3 n/a
2 TRCN0000304447 CTACTGAGCAGGGACCGATTT pLKO_005 1412 CDS 100% 10.800 15.120 N Ilf3 n/a
3 TRCN0000066797 CGGTGGACTACACTGTTCAAA pLKO.1 926 CDS 100% 5.625 7.875 N Ilf3 n/a
4 TRCN0000304446 TGTTAGTTACCATTACGTAAA pLKO_005 2784 3UTR 100% 10.800 8.640 N Ilf3 n/a
5 TRCN0000066793 CCCTGTTGTCAGAGAAGAAAT pLKO.1 580 5UTR 100% 13.200 9.240 N Ilf3 n/a
6 TRCN0000304445 GAACTACCAGTACAGATAAAG pLKO_005 2550 CDS 100% 13.200 9.240 N Ilf3 n/a
7 TRCN0000374151 GAATGCCCTGATGAGGTTAAA pLKO_005 1080 CDS 100% 13.200 9.240 N Ilf3 n/a
8 TRCN0000374204 CCAACTTGTCTCGGGAGATTG pLKO_005 2613 3UTR 100% 10.800 7.560 N Ilf3 n/a
9 TRCN0000066796 GCTGTCTCTGACTGGATTGAT pLKO.1 369 5UTR 100% 5.625 3.938 N Ilf3 n/a
10 TRCN0000316045 GCTGTCTCTGACTGGATTGAT pLKO_005 369 5UTR 100% 5.625 3.938 N Ilf3 n/a
11 TRCN0000066795 GCAAAGGCTTATGCTGCACTT pLKO.1 1597 CDS 100% 4.050 2.835 N Ilf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06449 pDONR223 100% 34.2% 37.2% None (many diffs) n/a
2 ccsbBroad304_06449 pLX_304 0% 34.2% 37.2% V5 (many diffs) n/a
3 TRCN0000467740 TATGAGTATTCTCCACCACAGTTG pLX_317 17.9% 34.2% 37.2% V5 (many diffs) n/a
Download CSV