Transcript: Mouse XM_017313153.1

PREDICTED: Mus musculus potassium inwardly-rectifying channel, subfamily J, member 5 (Kcnj5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnj5 (16521)
Length:
4828
CDS:
548..1954

Additional Resources:

NCBI RefSeq record:
XM_017313153.1
NBCI Gene record:
Kcnj5 (16521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069792 CTCGATTGTTAATGCCTTCAT pLKO.1 1219 CDS 100% 4.950 6.930 N Kcnj5 n/a
2 TRCN0000069791 CACCAGTTCTCACCTTGGAAA pLKO.1 1695 CDS 100% 4.950 3.465 N Kcnj5 n/a
3 TRCN0000069789 GCAGACCAAAGAAGGAGAATT pLKO.1 1420 CDS 100% 0.000 0.000 N Kcnj5 n/a
4 TRCN0000069790 GACCACAAGAAGATTCCCAAA pLKO.1 755 CDS 100% 4.050 2.430 N Kcnj5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06477 pDONR223 100% 79.4% 84.6% None (many diffs) n/a
2 ccsbBroad304_06477 pLX_304 0% 79.4% 84.6% V5 (many diffs) n/a
3 TRCN0000476437 CTCAGTTTATGAGATTATTAGAGC pLX_317 30.7% 79.4% 84.6% V5 (many diffs) n/a
Download CSV