Transcript: Mouse XM_017313491.1

PREDICTED: Mus musculus synaptotagmin binding, cytoplasmic RNA interacting protein (Syncrip), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syncrip (56403)
Length:
5444
CDS:
3834..4787

Additional Resources:

NCBI RefSeq record:
XM_017313491.1
NBCI Gene record:
Syncrip (56403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112051 CGTAGGCTAATGAGTGGTAAA pLKO.1 3825 5UTR 100% 10.800 15.120 N Syncrip n/a
2 TRCN0000308930 CGTAGGCTAATGAGTGGTAAA pLKO_005 3825 5UTR 100% 10.800 15.120 N Syncrip n/a
3 TRCN0000112054 CAACACGGTAACAGAAGAAAT pLKO.1 3953 CDS 100% 13.200 9.240 N Syncrip n/a
4 TRCN0000308927 CAACACGGTAACAGAAGAAAT pLKO_005 3953 CDS 100% 13.200 9.240 N Syncrip n/a
5 TRCN0000221640 CCTCCAGATTATTATGGATAT pLKO.1 4284 CDS 100% 10.800 6.480 N SYNCRIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02457 pDONR223 100% 40.2% 38% None (many diffs) n/a
2 ccsbBroad304_02457 pLX_304 0% 40.2% 38% V5 (many diffs) n/a
3 TRCN0000471371 GGATAATCAACTCACCCAGTTGTG pLX_317 29.9% 40.2% 38% V5 (many diffs) n/a
Download CSV