Transcript: Mouse XM_017313495.1

PREDICTED: Mus musculus secretory carrier membrane protein 5 (Scamp5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scamp5 (56807)
Length:
3252
CDS:
202..909

Additional Resources:

NCBI RefSeq record:
XM_017313495.1
NBCI Gene record:
Scamp5 (56807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306109 GGTGATGAGCCTAAGCTATTT pLKO_005 1336 3UTR 100% 13.200 9.240 N Scamp5 n/a
2 TRCN0000306042 TGCTCTTAGCATGGTTCATAA pLKO_005 702 CDS 100% 13.200 9.240 N Scamp5 n/a
3 TRCN0000105537 CCCAACTACACGTACTCCAAT pLKO.1 880 CDS 100% 4.950 3.465 N Scamp5 n/a
4 TRCN0000105536 GCCATGTTTCTACCAAGACTT pLKO.1 255 CDS 100% 4.950 3.465 N Scamp5 n/a
5 TRCN0000149276 GCCATGTTTCTACCAAGACTT pLKO.1 255 CDS 100% 4.950 3.465 N SCAMP5 n/a
6 TRCN0000325775 GCCATGTTTCTACCAAGACTT pLKO_005 255 CDS 100% 4.950 3.465 N Scamp5 n/a
7 TRCN0000105538 GCCCATTTACAAGGCCTTCAA pLKO.1 474 CDS 100% 4.950 3.465 N Scamp5 n/a
8 TRCN0000325707 GCCCATTTACAAGGCCTTCAA pLKO_005 474 CDS 100% 4.950 3.465 N Scamp5 n/a
9 TRCN0000105539 GCGGCTGGATTGCCACCATTT pLKO.1 596 CDS 100% 3.600 2.520 N Scamp5 n/a
10 TRCN0000353993 GCGGCTGGATTGCCACCATTT pLKO_005 596 CDS 100% 3.600 2.520 N Scamp5 n/a
11 TRCN0000105535 CCAGTCAACTTCCTGTCCTAT pLKO.1 2854 3UTR 100% 4.950 2.970 N Scamp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05167 pDONR223 100% 92.7% 98.7% None (many diffs) n/a
2 ccsbBroad304_05167 pLX_304 0% 92.7% 98.7% V5 (many diffs) n/a
Download CSV