Transcript: Mouse XM_017313500.1

PREDICTED: Mus musculus iron responsive element binding protein 2 (Ireb2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ireb2 (64602)
Length:
2508
CDS:
178..2508

Additional Resources:

NCBI RefSeq record:
XM_017313500.1
NBCI Gene record:
Ireb2 (64602)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114438 CGATAGAACTACCATAGCAAA pLKO.1 1278 CDS 100% 4.950 6.930 N Ireb2 n/a
2 TRCN0000351185 CGATAGAACTACCATAGCAAA pLKO_005 1278 CDS 100% 4.950 6.930 N Ireb2 n/a
3 TRCN0000114440 GTACGAAATTGTGATGGCTTT pLKO.1 328 CDS 100% 4.050 5.670 N Ireb2 n/a
4 TRCN0000334352 GTACGAAATTGTGATGGCTTT pLKO_005 328 CDS 100% 4.050 5.670 N Ireb2 n/a
5 TRCN0000114439 CCTTACTCAATACGGGTCCTA pLKO.1 295 CDS 100% 2.640 3.696 N Ireb2 n/a
6 TRCN0000334436 CCTTACTCAATACGGGTCCTA pLKO_005 295 CDS 100% 2.640 3.696 N Ireb2 n/a
7 TRCN0000430945 GGAAGCTGCTGTACGAAATTG pLKO_005 318 CDS 100% 13.200 9.240 N IREB2 n/a
8 TRCN0000114437 CCTGCCAGTTACTCTTACTTT pLKO.1 1101 CDS 100% 5.625 3.938 N Ireb2 n/a
9 TRCN0000334438 CCTGCCAGTTACTCTTACTTT pLKO_005 1101 CDS 100% 5.625 3.938 N Ireb2 n/a
10 TRCN0000056599 GCTGGAAAGTTTGTTGAGTTT pLKO.1 1225 CDS 100% 4.950 3.465 N IREB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15485 pDONR223 0% 40.8% 41.2% None (many diffs) n/a
2 ccsbBroad304_15485 pLX_304 0% 40.8% 41.2% V5 (many diffs) n/a
3 TRCN0000481134 AGGAGTCATAAACATACAACGTTA pLX_317 38.8% 40.8% 41.2% V5 (many diffs) n/a
Download CSV