Transcript: Mouse XM_017313805.1

PREDICTED: Mus musculus glutathione S-transferase, theta 2 (Gstt2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gstt2 (14872)
Length:
1478
CDS:
680..1435

Additional Resources:

NCBI RefSeq record:
XM_017313805.1
NBCI Gene record:
Gstt2 (14872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103440 CCAGGTGAACTGCTTAAACAA pLKO.1 817 CDS 100% 5.625 7.875 N Gstt2 n/a
2 TRCN0000103444 CGTACCGTGGATATACTCAAA pLKO.1 770 CDS 100% 4.950 6.930 N Gstt2 n/a
3 TRCN0000103442 CAGGTGAACTGCTTAAACAAA pLKO.1 818 CDS 100% 5.625 4.500 N Gstt2 n/a
4 TRCN0000103443 CGACAACATCCGTGGTACTTT pLKO.1 1009 CDS 100% 5.625 3.938 N Gstt2 n/a
5 TRCN0000103441 GCTCTTGGCTATAACCTGTTT pLKO.1 1232 CDS 100% 4.950 3.465 N Gstt2 n/a
6 TRCN0000163832 CTTCGCCAAGAAGAATGGCAT pLKO.1 736 CDS 100% 2.640 1.584 N GSTT2 n/a
7 TRCN0000162634 CTACATCTTCGCCAAGAAGAA pLKO.1 730 CDS 100% 0.495 0.248 Y GSTT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.