Transcript: Mouse XM_017313882.1

PREDICTED: Mus musculus clavesin 2 (Clvs2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clvs2 (215890)
Length:
2397
CDS:
441..1424

Additional Resources:

NCBI RefSeq record:
XM_017313882.1
NBCI Gene record:
Clvs2 (215890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105409 CTAGACCATGAGTATGATGAT pLKO.1 1236 CDS 100% 4.950 6.930 N Clvs2 n/a
2 TRCN0000148047 GAACAGTCTACACCAACTAAT pLKO.1 1139 CDS 100% 13.200 10.560 N CLVS2 n/a
3 TRCN0000149962 CATGGTAACAACCTGAACAGT pLKO.1 1125 CDS 100% 3.000 2.400 N CLVS2 n/a
4 TRCN0000423714 GGTACACACTGGTGGATATTT pLKO_005 829 CDS 100% 15.000 10.500 N CLVS2 n/a
5 TRCN0000105407 GCACTGAAACGAATGGATAAA pLKO.1 1362 CDS 100% 13.200 9.240 N Clvs2 n/a
6 TRCN0000105405 GCCAGTGATATGGACTACAAT pLKO.1 1720 3UTR 100% 5.625 3.938 N Clvs2 n/a
7 TRCN0000105406 CCAACTAATTCATCCTGAGAT pLKO.1 1151 CDS 100% 4.950 3.465 N Clvs2 n/a
8 TRCN0000105408 CAGAGCTTCAAGTAAATGGAT pLKO.1 892 CDS 100% 3.000 2.100 N Clvs2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04897 pDONR223 100% 90.7% 97.8% None (many diffs) n/a
2 ccsbBroad304_04897 pLX_304 0% 90.7% 97.8% V5 (many diffs) n/a
3 TRCN0000470359 TGAGTCATAATAGCTTTCTTATCA pLX_317 15.1% 90.7% 97.8% V5 (many diffs) n/a
Download CSV