Transcript: Mouse XM_017313954.1

PREDICTED: Mus musculus family with sequence similarity 19, member A2 (Fam19a2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam19a2 (268354)
Length:
5718
CDS:
2917..3429

Additional Resources:

NCBI RefSeq record:
XM_017313954.1
NBCI Gene record:
Fam19a2 (268354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197571 CAAGGAAAGCTTCTGATAATT pLKO.1 3064 CDS 100% 15.000 10.500 N Fam19a2 n/a
2 TRCN0000182812 CGCTGCACAGATGCTGTAATA pLKO.1 3176 CDS 100% 13.200 9.240 N Fam19a2 n/a
3 TRCN0000215875 CATCGATAATGATAATCATTG pLKO.1 4014 3UTR 100% 10.800 7.560 N Fam19a2 n/a
4 TRCN0000177424 GCTGTAATAAGAACAAGATAG pLKO.1 3188 CDS 100% 10.800 7.560 N Fam19a2 n/a
5 TRCN0000177266 GTTCCTCTGGAAACAAAGTAA pLKO.1 3386 CDS 100% 5.625 3.938 N Fam19a2 n/a
6 TRCN0000181738 GATGCATCCATAGTGGAACAA pLKO.1 3289 CDS 100% 4.950 3.465 N Fam19a2 n/a
7 TRCN0000182840 CAACCATCACAAAGCTCACCA pLKO.1 3126 CDS 100% 2.640 1.848 N Fam19a2 n/a
8 TRCN0000182318 GAGCTGTTCCTCTGGAAACAA pLKO.1 3381 CDS 100% 5.625 3.375 N Fam19a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13581 pDONR223 100% 68.2% 73.5% None (many diffs) n/a
2 ccsbBroad304_13581 pLX_304 0% 68.2% 73.5% V5 (many diffs) n/a
3 TRCN0000477466 ATATCTCGGTCGGCCGAACTTTGC pLX_317 98.5% 68.2% 73.5% V5 (many diffs) n/a
Download CSV