Transcript: Mouse XM_017314135.1

PREDICTED: Mus musculus family with sequence similarity 184, member A (Fam184a), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam184a (75906)
Length:
3893
CDS:
355..3558

Additional Resources:

NCBI RefSeq record:
XM_017314135.1
NBCI Gene record:
Fam184a (75906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283409 CACTCTCTGAGGTACTATATT pLKO_005 3787 3UTR 100% 15.000 21.000 N Fam184a n/a
2 TRCN0000267024 GAACGAGACCAGGTCATAAAG pLKO_005 3409 CDS 100% 13.200 18.480 N Fam184a n/a
3 TRCN0000148061 GCTAGTCATATTGGAATGCTT pLKO.1 1510 CDS 100% 3.000 4.200 N FAM184A n/a
4 TRCN0000283411 AGACCAAGGATGCCCTATTAA pLKO_005 2150 CDS 100% 15.000 10.500 N Fam184a n/a
5 TRCN0000267025 ACATGCGGCTTCCATTGATTT pLKO_005 2889 CDS 100% 13.200 9.240 N Fam184a n/a
6 TRCN0000267023 GACCGAGTTTGAAGCCTATAA pLKO_005 741 CDS 100% 13.200 9.240 N Fam184a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12577 pDONR223 100% 74.2% 77.7% None (many diffs) n/a
2 ccsbBroad304_12577 pLX_304 0% 74.2% 77.7% V5 (many diffs) n/a
3 TRCN0000481543 AGACAATGCAAGACCGGAAAGCGG pLX_317 12.4% 74.2% 77.7% V5 (many diffs) n/a
Download CSV