Transcript: Mouse XM_017314147.1

PREDICTED: Mus musculus transmembrane protein 200A (Tmem200a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem200a (77220)
Length:
3629
CDS:
421..1917

Additional Resources:

NCBI RefSeq record:
XM_017314147.1
NBCI Gene record:
Tmem200a (77220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176845 GCCTAAACATTTGTGAACATT pLKO.1 3350 3UTR 100% 5.625 4.500 N Tmem200a n/a
2 TRCN0000200353 GCTGGTGTCCATCATAGGAAT pLKO.1 648 CDS 100% 4.950 3.960 N Tmem200a n/a
3 TRCN0000217192 CGTTACTCCCAAGGAACAATT pLKO.1 1469 CDS 100% 13.200 9.240 N Tmem200a n/a
4 TRCN0000197972 CTACCTGTGATCAAGCTTAAT pLKO.1 1309 CDS 100% 13.200 9.240 N Tmem200a n/a
5 TRCN0000177180 GATCTCATAACAACTTGAGTT pLKO.1 1835 CDS 100% 4.950 3.465 N Tmem200a n/a
6 TRCN0000200300 GCGTGTTAGAAATGGCTGGTT pLKO.1 2022 3UTR 100% 2.640 1.848 N Tmem200a n/a
7 TRCN0000181865 GTAACAACTTGAAGCGAGGAA pLKO.1 1877 CDS 100% 2.640 1.848 N Tmem200a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09401 pDONR223 100% 81.1% 89.3% None (many diffs) n/a
2 ccsbBroad304_09401 pLX_304 0% 81.1% 89.3% V5 (many diffs) n/a
3 TRCN0000477828 GATGGCCCCGTTTTGCACTAACTG pLX_317 26.1% 81.1% 89.3% V5 (many diffs) n/a
Download CSV