Transcript: Mouse XM_017314273.1

PREDICTED: Mus musculus K(lysine) acetyltransferase 2A (Kat2a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kat2a (14534)
Length:
3337
CDS:
1337..2845

Additional Resources:

NCBI RefSeq record:
XM_017314273.1
NBCI Gene record:
Kat2a (14534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039404 GCTACCTACAAAGTCAATTAT pLKO.1 914 5UTR 100% 15.000 12.000 N Kat2a n/a
2 TRCN0000324029 GCTACCTACAAAGTCAATTAT pLKO_005 914 5UTR 100% 15.000 12.000 N Kat2a n/a
3 TRCN0000039406 GAAGCCTTCTACGGTCCATTT pLKO.1 1014 5UTR 100% 10.800 7.560 N Kat2a n/a
4 TRCN0000324007 GAAGCCTTCTACGGTCCATTT pLKO_005 1014 5UTR 100% 10.800 7.560 N Kat2a n/a
5 TRCN0000039408 CCTAAAGGAGTACCACATCAA pLKO.1 2035 CDS 100% 4.950 3.465 N Kat2a n/a
6 TRCN0000324075 CCTAAAGGAGTACCACATCAA pLKO_005 2035 CDS 100% 4.950 3.465 N Kat2a n/a
7 TRCN0000039407 CGTGCCAAGAAGCTTGAGAAA pLKO.1 353 5UTR 100% 4.950 3.465 N Kat2a n/a
8 TRCN0000324018 CGTGCCAAGAAGCTTGAGAAA pLKO_005 353 5UTR 100% 4.950 3.465 N Kat2a n/a
9 TRCN0000039405 GAGATCATCAAGAAGTTGATT pLKO.1 2261 CDS 100% 0.563 0.394 N Kat2a n/a
10 TRCN0000324012 GAGATCATCAAGAAGTTGATT pLKO_005 2261 CDS 100% 0.563 0.394 N Kat2a n/a
11 TRCN0000038881 CCTGGAGAAGTTCTTCTACTT pLKO.1 2791 CDS 100% 4.950 2.970 N KAT2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489820 TGTTTTAACCTCATGTTACAAAGT pLX_317 15.7% 49.5% 54% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492005 CGCCCTAGTAAAAGAAATATTGTG pLX_317 17.3% 49.5% 53.9% V5 (many diffs) n/a
Download CSV