Transcript: Mouse XM_017314290.1

PREDICTED: Mus musculus forkhead box N1 (Foxn1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Foxn1 (15218)
Length:
3189
CDS:
69..2015

Additional Resources:

NCBI RefSeq record:
XM_017314290.1
NBCI Gene record:
Foxn1 (15218)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086596 GCAGAGGCTTGGTGCAATAAA pLKO.1 597 CDS 100% 15.000 12.000 N Foxn1 n/a
2 TRCN0000434672 AGCCAGGAACACAACCAAATT pLKO_005 630 CDS 100% 13.200 9.240 N Foxn1 n/a
3 TRCN0000427401 GACTTCGACTTCCAGGGAAAT pLKO_005 1680 CDS 100% 10.800 7.560 N Foxn1 n/a
4 TRCN0000417770 TCCGGAAGTTCCTCTCGAAAG pLKO_005 1074 CDS 100% 6.000 4.200 N Foxn1 n/a
5 TRCN0000086595 CCAGTCAGTGAAATCTACAAT pLKO.1 945 CDS 100% 5.625 3.938 N Foxn1 n/a
6 TRCN0000086593 CTCACCTTAAAGGTCAAAGAA pLKO.1 2069 3UTR 100% 5.625 3.938 N Foxn1 n/a
7 TRCN0000086594 GCACTTGATGGACACTCCTTT pLKO.1 495 CDS 100% 4.950 3.465 N Foxn1 n/a
8 TRCN0000086597 CAGTCAGTGAAATCTACAATT pLKO.1 946 CDS 100% 13.200 7.920 N Foxn1 n/a
9 TRCN0000013197 CCTCCTGCTATGGGCAGACAT pLKO.1 1411 CDS 100% 1.650 0.990 N FOXN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.