Transcript: Mouse XM_017314318.1

PREDICTED: Mus musculus myosin, heavy polypeptide 1, skeletal muscle, adult (Myh1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myh1 (17879)
Length:
6020
CDS:
86..5914

Additional Resources:

NCBI RefSeq record:
XM_017314318.1
NBCI Gene record:
Myh1 (17879)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182910 CATCTCCAAATCTAAGGGAAA pLKO.1 3817 CDS 100% 4.050 3.240 N Myh1 n/a
2 TRCN0000183052 CTGAATAAGCTAATGACCAAT pLKO.1 2069 CDS 100% 4.950 3.465 N Myh1 n/a
3 TRCN0000159064 GCCAACATGAAGGAAGAATTT pLKO.1 2654 CDS 100% 13.200 7.920 N MYH1 n/a
4 TRCN0000179778 GCAGACTTCAAGCAGAGATAT pLKO.1 2252 CDS 100% 13.200 6.600 Y Myh1 n/a
5 TRCN0000163202 GCCCTGGATGAAGCTGTATTT pLKO.1 2587 CDS 100% 13.200 6.600 Y MYH1 n/a
6 TRCN0000179107 CCACAGATAGTGCCATTGATA pLKO.1 1086 CDS 100% 5.625 2.813 Y Myh1 n/a
7 TRCN0000109313 CCTCCCAAGTACGACAAGATT pLKO.1 329 CDS 100% 5.625 2.813 Y Myh4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.