Transcript: Mouse XM_017314685.1

PREDICTED: Mus musculus G protein pathway suppressor 2 (Gps2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gps2 (56310)
Length:
1469
CDS:
317..1378

Additional Resources:

NCBI RefSeq record:
XM_017314685.1
NBCI Gene record:
Gps2 (56310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311501 ATGCAGTGCATGGCCACTTTC pLKO_005 1005 CDS 100% 10.800 8.640 N Gps2 n/a
2 TRCN0000306316 GGCCAACACAACCAGCCTATA pLKO_005 909 CDS 100% 10.800 8.640 N Gps2 n/a
3 TRCN0000306257 TGATGGAACAGAAGATGAAAG pLKO_005 432 CDS 100% 10.800 7.560 N Gps2 n/a
4 TRCN0000037100 CACTCTGACATCAGCTGCATA pLKO.1 643 CDS 100% 4.950 3.465 N Gps2 n/a
5 TRCN0000037133 GATGATGGAACAGAAGATGAA pLKO.1 430 CDS 100% 4.950 3.465 N LOC384890 n/a
6 TRCN0000037131 CAGGAGAAGCTTTCTGCTCTA pLKO.1 533 CDS 100% 4.050 2.835 N LOC384890 n/a
7 TRCN0000037101 CAGTACCCTCTCTTTGCAGAA pLKO.1 1135 CDS 100% 4.050 2.835 N Gps2 n/a
8 TRCN0000326486 CAGTACCCTCTCTTTGCAGAA pLKO_005 1135 CDS 100% 4.050 2.835 N Gps2 n/a
9 TRCN0000037099 CCAGAACATGGACAATTCCAA pLKO.1 839 CDS 100% 3.000 2.100 N Gps2 n/a
10 TRCN0000037129 GAGGTGGACAAGATGATGGAA pLKO.1 419 CDS 100% 3.000 2.100 N LOC384890 n/a
11 TRCN0000037102 ACAGATACAAGCAGCAGGGAA pLKO.1 1273 CDS 100% 2.640 1.848 N Gps2 n/a
12 TRCN0000037103 GCCAAGCAGATGTTTGGACCA pLKO.1 764 CDS 100% 2.160 1.512 N Gps2 n/a
13 TRCN0000326415 GCCAAGCAGATGTTTGGACCA pLKO_005 764 CDS 100% 2.160 1.512 N Gps2 n/a
14 TRCN0000037130 GAGCAGGAGAGAAGAAAGAAA pLKO.1 455 CDS 100% 5.625 3.375 N LOC384890 n/a
15 TRCN0000037127 CCTCTCTTTGCAGAAACAGAT pLKO.1 1141 CDS 100% 4.950 2.970 N LOC382047 n/a
16 TRCN0000037132 GACCAAGGAACAGATCCTGAA pLKO.1 508 CDS 100% 4.050 2.430 N LOC384890 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00684 pDONR223 100% 84.5% 90.3% None (many diffs) n/a
2 ccsbBroad304_00684 pLX_304 0% 84.5% 90.3% V5 (many diffs) n/a
3 TRCN0000466248 ATTTCCTGCGCAACTCTCGGAACC pLX_317 32.3% 84.5% 90.3% V5 (many diffs) n/a
Download CSV