Transcript: Mouse XM_017314728.1

PREDICTED: Mus musculus 5'-nucleotidase, cytosolic IIIB (Nt5c3b), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nt5c3b (68106)
Length:
1263
CDS:
99..800

Additional Resources:

NCBI RefSeq record:
XM_017314728.1
NBCI Gene record:
Nt5c3b (68106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194081 GAACATTCTCAAGATCGGCTT pLKO.1 632 CDS 100% 2.160 1.728 N Nt5c3b n/a
2 TRCN0000246419 GAGCTCTTTCACCACTATTAT pLKO_005 132 CDS 100% 15.000 10.500 N Nt5c3b n/a
3 TRCN0000257533 GATGCTCAGGGAGGGCTATAA pLKO_005 293 CDS 100% 13.200 9.240 N Nt5c3b n/a
4 TRCN0000175680 GCTCATTCACACCTACAACAA pLKO.1 491 CDS 100% 4.950 3.465 N Nt5c3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13046 pDONR223 100% 78.6% 77.4% None (many diffs) n/a
2 ccsbBroad304_13046 pLX_304 0% 78.6% 77.4% V5 (many diffs) n/a
3 TRCN0000473044 ACGGGCCTAAATAGGACCCCTGAT pLX_317 62% 78.6% 77.4% V5 (many diffs) n/a
Download CSV