Transcript: Mouse XM_017314829.1

PREDICTED: Mus musculus transmembrane protein 101 (Tmem101), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem101 (76547)
Length:
1464
CDS:
125..724

Additional Resources:

NCBI RefSeq record:
XM_017314829.1
NBCI Gene record:
Tmem101 (76547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217414 GGCTAAAGGTCCGTATGTATT pLKO.1 261 CDS 100% 13.200 18.480 N Tmem101 n/a
2 TRCN0000246840 GGCTAAAGGTCCGTATGTATT pLKO_005 261 CDS 100% 13.200 18.480 N Tmem101 n/a
3 TRCN0000246838 CCTTCTTGTCGGGTTACTATG pLKO_005 528 CDS 100% 10.800 15.120 N Tmem101 n/a
4 TRCN0000174044 CTTCATGTCCTTCGGAGTGAA pLKO.1 151 CDS 100% 4.950 3.960 N Tmem101 n/a
5 TRCN0000216669 CAGCTGTTCTTCGTGCTTTAT pLKO.1 491 CDS 100% 13.200 9.240 N Tmem101 n/a
6 TRCN0000246841 CATCCCAGTGCCTTATCTATA pLKO_005 97 5UTR 100% 13.200 9.240 N Tmem101 n/a
7 TRCN0000194634 GCTGGCCCAGTTGTTGTTTAT pLKO.1 792 3UTR 100% 13.200 9.240 N Tmem101 n/a
8 TRCN0000246837 CCTTGCGCTAAAGCTTCATAG pLKO_005 893 3UTR 100% 10.800 7.560 N Tmem101 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04384 pDONR223 100% 67% 75.4% None (many diffs) n/a
2 ccsbBroad304_04384 pLX_304 0% 67% 75.4% V5 (many diffs) n/a
3 TRCN0000471909 GTGATAAGTTCAATAAACATACGT pLX_317 63.5% 67% 75.4% V5 (many diffs) n/a
Download CSV