Transcript: Mouse XM_017314903.1

PREDICTED: Mus musculus endothelin converting enzyme-like 1 (Ecel1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ecel1 (13599)
Length:
2967
CDS:
308..2635

Additional Resources:

NCBI RefSeq record:
XM_017314903.1
NBCI Gene record:
Ecel1 (13599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031179 CGGGTCTATCTTCCTTCCCAA pLKO.1 2732 3UTR 100% 2.640 3.696 N Ecel1 n/a
2 TRCN0000031181 CATCCGATTCAGTATCCAGTT pLKO.1 1933 CDS 100% 4.050 3.240 N Ecel1 n/a
3 TRCN0000031180 CGTATCCCAGTTTGAGGAATT pLKO.1 2548 CDS 100% 0.000 0.000 N Ecel1 n/a
4 TRCN0000031183 GAGTTCCAGGAAGTCAAGTAT pLKO.1 344 CDS 100% 5.625 3.938 N Ecel1 n/a
5 TRCN0000031182 CCAATATCTCTGTGTCAGAAT pLKO.1 1269 CDS 100% 4.950 3.465 N Ecel1 n/a
6 TRCN0000046999 GCGCTCAATGCCTACTATCTA pLKO.1 2012 CDS 100% 5.625 4.500 N ECEL1 n/a
7 TRCN0000047001 CCCGACGACAAGCTCACCTAT pLKO.1 731 CDS 100% 1.650 1.155 N ECEL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07415 pDONR223 100% 88.6% 94.7% None (many diffs) n/a
2 ccsbBroad304_07415 pLX_304 0% 88.6% 94.7% V5 (many diffs) n/a
3 TRCN0000480017 GTCCCGGCGGGTACTAGCGGGCGC pLX_317 17.3% 88.6% 94.7% V5 (many diffs) n/a
Download CSV