Transcript: Mouse XM_017314935.1

PREDICTED: Mus musculus zinc finger and BTB domain containing 25 (Zbtb25), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb25 (109929)
Length:
4452
CDS:
3246..4226

Additional Resources:

NCBI RefSeq record:
XM_017314935.1
NBCI Gene record:
Zbtb25 (109929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241489 CATCTAATTTGTATGGTATTC pLKO_005 3280 CDS 100% 10.800 15.120 N Zbtb25 n/a
2 TRCN0000241491 AGGTAAATCCTACAGATATAA pLKO_005 4034 CDS 100% 15.000 10.500 N Zbtb25 n/a
3 TRCN0000241490 TACTGATCTTGGAGGAGATTT pLKO_005 4250 3UTR 100% 13.200 9.240 N Zbtb25 n/a
4 TRCN0000175181 CAAAGTCCACTTATGCCATTA pLKO.1 3614 CDS 100% 10.800 7.560 N Zbtb25 n/a
5 TRCN0000241493 CAGATTAGTCAAGTATCTTTG pLKO_005 3879 CDS 100% 10.800 7.560 N Zbtb25 n/a
6 TRCN0000241492 CAGTATCAAAGTCCACTTATG pLKO_005 3608 CDS 100% 10.800 7.560 N Zbtb25 n/a
7 TRCN0000193305 CTTTGCAGATTAGTCAAGTAT pLKO.1 3874 CDS 100% 5.625 3.938 N Zbtb25 n/a
8 TRCN0000174537 CAAAGGTAAATCCTACAGATA pLKO.1 4031 CDS 100% 4.950 3.465 N Zbtb25 n/a
9 TRCN0000021296 GCCAGTAGAATTAAACTGTAA pLKO.1 3917 CDS 100% 4.950 3.465 N ZBTB25 n/a
10 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 496 5UTR 100% 2.640 1.320 Y BC028528 n/a
11 TRCN0000192383 CCAGAGGTTCTGAGTTCAATT pLKO.1 1797 5UTR 100% 13.200 6.600 Y Lrrc29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01803 pDONR223 100% 65.2% 65.3% None (many diffs) n/a
2 ccsbBroad304_01803 pLX_304 0% 65.2% 65.3% V5 (many diffs) n/a
3 TRCN0000481016 CAGCGCAGAGCACTAAGCAGGTTG pLX_317 31.6% 65.2% 65.3% V5 (many diffs) n/a
Download CSV