Transcript: Mouse XM_017314937.1

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class H (Pigh), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pigh (110417)
Length:
432
CDS:
93..416

Additional Resources:

NCBI RefSeq record:
XM_017314937.1
NBCI Gene record:
Pigh (110417)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314937.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098792 CCTGCTTGGTTACCTCCATTT pLKO.1 384 CDS 100% 10.800 7.560 N Pigh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314937.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01200 pDONR223 100% 34.4% 24.7% None (many diffs) n/a
2 ccsbBroad304_01200 pLX_304 0% 34.4% 24.7% V5 (many diffs) n/a
3 TRCN0000467893 TCAGGCGGTGCCCGAAGAAGGGCC pLX_317 69% 34.4% 24.7% V5 (many diffs) n/a
Download CSV