Transcript: Mouse XM_017315014.1

PREDICTED: Mus musculus zinc finger, FYVE domain containing 26 (Zfyve26), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfyve26 (211978)
Length:
7475
CDS:
720..5855

Additional Resources:

NCBI RefSeq record:
XM_017315014.1
NBCI Gene record:
Zfyve26 (211978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238656 CCCGCGTAGAACATAAGATTG pLKO_005 880 CDS 100% 10.800 15.120 N Zfyve26 n/a
2 TRCN0000238659 GAGCGATACCAAGAGGTAATC pLKO_005 849 CDS 100% 10.800 15.120 N Zfyve26 n/a
3 TRCN0000238655 TACCGCCATGTACCATCTTTA pLKO_005 4293 CDS 100% 0.000 0.000 N Zfyve26 n/a
4 TRCN0000238658 TACGTTCTGCCTACCTGATTG pLKO_005 5680 CDS 100% 10.800 7.560 N Zfyve26 n/a
5 TRCN0000238657 TGTACCTCTTGAATTAGTTAA pLKO_005 6715 3UTR 100% 13.200 7.920 N Zfyve26 n/a
6 TRCN0000154083 GCCAAGATGATGTTCGTCAAA pLKO.1 4191 CDS 100% 4.950 3.465 N ZFYVE26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11741 pDONR223 100% 17% 17.7% None (many diffs) n/a
2 ccsbBroad304_11741 pLX_304 0% 17% 17.7% V5 (many diffs) n/a
3 TRCN0000474249 TAGCTTTCTACTTACTCCCCACTC pLX_317 38.7% 17% 17.7% V5 (many diffs) n/a
Download CSV