Transcript: Mouse XM_017315136.1

PREDICTED: Mus musculus cleavage and polyadenylation specificity factor 3 (Cpsf3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpsf3 (54451)
Length:
2425
CDS:
303..2339

Additional Resources:

NCBI RefSeq record:
XM_017315136.1
NBCI Gene record:
Cpsf3 (54451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119572 CCAGCAAACCAGTGAATTTAT pLKO.1 1481 CDS 100% 15.000 12.000 N Cpsf3 n/a
2 TRCN0000317840 CCAGCAAACCAGTGAATTTAT pLKO_005 1481 CDS 100% 15.000 12.000 N Cpsf3 n/a
3 TRCN0000119573 GCTGCATGACATACCCATTTA pLKO.1 1070 CDS 100% 13.200 10.560 N Cpsf3 n/a
4 TRCN0000119574 GCATGACATACCCATTTACTA pLKO.1 1073 CDS 100% 5.625 4.500 N Cpsf3 n/a
5 TRCN0000317779 GCATGACATACCCATTTACTA pLKO_005 1073 CDS 100% 5.625 4.500 N Cpsf3 n/a
6 TRCN0000119576 CCTGCTCTGAAGGTGTTCAAA pLKO.1 1920 CDS 100% 5.625 3.938 N Cpsf3 n/a
7 TRCN0000317841 CCTGCTCTGAAGGTGTTCAAA pLKO_005 1920 CDS 100% 5.625 3.938 N Cpsf3 n/a
8 TRCN0000119575 GCGAGAAGCAAGATTCTGCAA pLKO.1 935 CDS 100% 2.640 1.848 N Cpsf3 n/a
9 TRCN0000317777 GCGAGAAGCAAGATTCTGCAA pLKO_005 935 CDS 100% 2.640 1.848 N Cpsf3 n/a
10 TRCN0000074985 CCAGTGAATTTATTCGTGCTT pLKO.1 1489 CDS 100% 2.640 1.848 N CPSF3 n/a
11 TRCN0000291969 CCAGTGAATTTATTCGTGCTT pLKO_005 1489 CDS 100% 2.640 1.848 N CPSF3 n/a
12 TRCN0000074986 GCACGTTTACAGCAAGAGGTT pLKO.1 2105 CDS 100% 2.640 1.848 N CPSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.