Transcript: Mouse XM_017315229.1

PREDICTED: Mus musculus additional sex combs like 2 (Drosophila) (Asxl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asxl2 (75302)
Length:
12995
CDS:
300..4556

Additional Resources:

NCBI RefSeq record:
XM_017315229.1
NBCI Gene record:
Asxl2 (75302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426893 GCGATCATAGTGCTGATTATG pLKO_005 4954 3UTR 100% 13.200 18.480 N Asxl2 n/a
2 TRCN0000121338 GCACATAAACAGATGACTCAT pLKO.1 4053 CDS 100% 4.950 6.930 N Asxl2 n/a
3 TRCN0000424207 TATAGTAGGTCTGAGTCAAAT pLKO_005 4713 3UTR 100% 13.200 10.560 N Asxl2 n/a
4 TRCN0000121340 CCTCAAGTGATCCCAAAGCAA pLKO.1 1492 CDS 100% 3.000 2.400 N Asxl2 n/a
5 TRCN0000423557 CTGATTCCATTCTGGTTAATA pLKO_005 1129 CDS 100% 15.000 10.500 N Asxl2 n/a
6 TRCN0000422478 AGAATGCAGGTCTTCACATTT pLKO_005 4675 3UTR 100% 13.200 9.240 N Asxl2 n/a
7 TRCN0000421673 ATACACCCATGAGTCATAAAG pLKO_005 376 CDS 100% 13.200 9.240 N ASXL2 n/a
8 TRCN0000426518 ATACACCCATGAGTCATAAAG pLKO_005 376 CDS 100% 13.200 9.240 N Asxl2 n/a
9 TRCN0000121339 CCTGCCAGTCAAGCAATGAAT pLKO.1 4350 CDS 100% 5.625 3.938 N Asxl2 n/a
10 TRCN0000121337 CCCAGTCAGTACAAATGGAAA pLKO.1 2456 CDS 100% 4.950 3.465 N Asxl2 n/a
11 TRCN0000121341 GAAACCCATCAAGAGCCCTAA pLKO.1 1730 CDS 100% 4.050 2.835 N Asxl2 n/a
12 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 5989 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
13 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 5950 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12193 pDONR223 100% 54.1% 50.9% None (many diffs) n/a
2 ccsbBroad304_12193 pLX_304 0% 54.1% 50.9% V5 (many diffs) n/a
3 TRCN0000481007 TTCACGTGTTACCCAGATATAACA pLX_317 14.4% 54.1% 50.9% V5 (many diffs) n/a
Download CSV