Transcript: Mouse XM_017315517.1

PREDICTED: Mus musculus mitogen-activated protein kinase kinase kinase 1 (Map3k1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map3k1 (26401)
Length:
7567
CDS:
3400..7407

Additional Resources:

NCBI RefSeq record:
XM_017315517.1
NBCI Gene record:
Map3k1 (26401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361512 TCCGTACCACGTGGTAGTTAA pLKO_005 7391 CDS 100% 13.200 18.480 N Map3k1 n/a
2 TRCN0000025183 GCAGATTCCTTCCGCTTACAA pLKO.1 4554 CDS 100% 5.625 7.875 N Map3k1 n/a
3 TRCN0000361511 GGTGAAGCCAATCCCTATTAA pLKO_005 3546 CDS 100% 15.000 10.500 N Map3k1 n/a
4 TRCN0000361582 TCAAGGAGTCAGTCGTCATTA pLKO_005 6890 CDS 100% 13.200 9.240 N Map3k1 n/a
5 TRCN0000025182 CCAGTAACATACACAGGCCAA pLKO.1 6029 CDS 100% 2.160 1.512 N Map3k1 n/a
6 TRCN0000025181 CCTCTGTCTTATAGACAGGTT pLKO.1 5184 CDS 100% 0.264 0.185 N Map3k1 n/a
7 TRCN0000025179 GCGCCATTATAGAAATGGCTT pLKO.1 7178 CDS 100% 0.264 0.185 N Map3k1 n/a
8 TRCN0000361513 CTTTGTCTCATGCTCAATTAA pLKO_005 5798 CDS 100% 15.000 9.000 N Map3k1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2750 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.