Transcript: Mouse XM_017315520.1

PREDICTED: Mus musculus osteomodulin (Omd), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Omd (27047)
Length:
1834
CDS:
338..1609

Additional Resources:

NCBI RefSeq record:
XM_017315520.1
NBCI Gene record:
Omd (27047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094221 CCCTCGTATACACAGTATTTA pLKO.1 1399 CDS 100% 15.000 21.000 N Omd n/a
2 TRCN0000352108 CCCTCGTATACACAGTATTTA pLKO_005 1399 CDS 100% 15.000 21.000 N Omd n/a
3 TRCN0000094220 CGGTGAAACAATTCAACTGAA pLKO.1 1444 CDS 100% 4.950 3.960 N Omd n/a
4 TRCN0000352109 CGGTGAAACAATTCAACTGAA pLKO_005 1444 CDS 100% 4.950 3.960 N Omd n/a
5 TRCN0000094223 CCTTCATCACTTATGTATCTA pLKO.1 1031 CDS 100% 5.625 3.938 N Omd n/a
6 TRCN0000352107 CCTTCATCACTTATGTATCTA pLKO_005 1031 CDS 100% 5.625 3.938 N Omd n/a
7 TRCN0000094219 GCCTCCATAAAGCCTTACTAA pLKO.1 1622 3UTR 100% 5.625 3.938 N Omd n/a
8 TRCN0000352030 GCCTCCATAAAGCCTTACTAA pLKO_005 1622 3UTR 100% 5.625 3.938 N Omd n/a
9 TRCN0000094222 GCCAATATGAAGCTTACCGAT pLKO.1 396 CDS 100% 2.640 1.848 N Omd n/a
10 TRCN0000352106 GCCAATATGAAGCTTACCGAT pLKO_005 396 CDS 100% 2.640 1.848 N Omd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01115 pDONR223 100% 84.1% 78.6% None (many diffs) n/a
2 ccsbBroad304_01115 pLX_304 0% 84.1% 78.6% V5 (many diffs) n/a
3 TRCN0000478092 TCGGGTACGGCTGGAAAGGACTTA pLX_317 20.2% 84.1% 78.6% V5 (many diffs) n/a
Download CSV