Transcript: Mouse XM_017315561.1

PREDICTED: Mus musculus guanosine monophosphate reductase (Gmpr), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gmpr (66355)
Length:
1221
CDS:
52..888

Additional Resources:

NCBI RefSeq record:
XM_017315561.1
NBCI Gene record:
Gmpr (66355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042228 GCCAATGGGTATTCAGAGCAT pLKO.1 241 CDS 100% 2.640 3.696 N Gmpr n/a
2 TRCN0000042232 CAACAGCACAACACGGTGTTT pLKO.1 862 CDS 100% 4.950 3.960 N Gmpr n/a
3 TRCN0000042231 ACCGTGGAAGTGCCTTACAAA pLKO.1 724 CDS 100% 5.625 3.938 N Gmpr n/a
4 TRCN0000042229 GCAGAATGATCTTGAGAGGAT pLKO.1 168 CDS 100% 2.640 1.848 N Gmpr n/a
5 TRCN0000042230 CATGCCATGTTTACAGCCGTT pLKO.1 2 5UTR 100% 2.160 1.512 N Gmpr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06289 pDONR223 100% 67% 70.1% None (many diffs) n/a
2 ccsbBroad304_06289 pLX_304 0% 67% 70.1% V5 (many diffs) n/a
3 TRCN0000471850 GGTACATGTACCGTGAATTCCGGT pLX_317 43.4% 67% 70.1% V5 (many diffs) n/a
Download CSV