Transcript: Mouse XM_017315646.1

PREDICTED: Mus musculus zinc finger with KRAB and SCAN domains 8 (Zkscan8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zkscan8 (93681)
Length:
8825
CDS:
249..2045

Additional Resources:

NCBI RefSeq record:
XM_017315646.1
NBCI Gene record:
Zkscan8 (93681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013017 GCTTCTTGATCCATCACAGAA pLKO.1 1010 CDS 100% 4.950 3.960 N ZKSCAN8 n/a
2 TRCN0000217953 ACACAAGAGAGACGACATAAA pLKO_005 1257 CDS 100% 13.200 9.240 N ZKSCAN8 n/a
3 TRCN0000095903 CAGACTTTGGAAAGGATTGAA pLKO.1 957 CDS 100% 5.625 3.938 N Zkscan8 n/a
4 TRCN0000095901 GACGACATAAATGTGATGAAT pLKO.1 1267 CDS 100% 5.625 3.938 N Zkscan8 n/a
5 TRCN0000095899 CATTAGAGAAACCATGTACTA pLKO.1 2080 3UTR 100% 4.950 3.465 N Zkscan8 n/a
6 TRCN0000095900 CCTCCAAGTATTCACGTACAA pLKO.1 738 CDS 100% 4.950 3.465 N Zkscan8 n/a
7 TRCN0000095902 CCTGAAGAGGATCTTGTCATT pLKO.1 303 CDS 100% 4.950 3.465 N Zkscan8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01816 pDONR223 100% 85% 84.7% None (many diffs) n/a
2 ccsbBroad304_01816 pLX_304 0% 85% 84.7% V5 (many diffs) n/a
3 TRCN0000477419 CGGGCTCGAAACTTATCCGTGGAC pLX_317 22.7% 85% 84.7% V5 (many diffs) n/a
4 ccsbBroadEn_07171 pDONR223 100% 84.9% 84.7% None (many diffs) n/a
5 ccsbBroad304_07171 pLX_304 0% 84.9% 84.7% V5 (many diffs) n/a
6 TRCN0000473447 CCGAGAACCACTAAGGGCTCACAT pLX_317 31.3% 84.9% 84.7% V5 (many diffs) n/a
Download CSV