Transcript: Mouse XM_017315889.1

PREDICTED: Mus musculus Kruppel-like factor 12 (Klf12), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klf12 (16597)
Length:
10799
CDS:
789..1847

Additional Resources:

NCBI RefSeq record:
XM_017315889.1
NBCI Gene record:
Klf12 (16597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226306 GTGACCTTAGATAGCGTTAAT pLKO_005 1380 CDS 100% 13.200 10.560 N Klf12 n/a
2 TRCN0000230481 GTGACCTTAGATAGCGTTAAT pLKO_005 1380 CDS 100% 13.200 10.560 N KLF12 n/a
3 TRCN0000226308 ACTTCGAAGGGTGCAACAAAG pLKO_005 1597 CDS 100% 10.800 8.640 N Klf12 n/a
4 TRCN0000096408 GTCCGAGGAAATCGAATGAAT pLKO.1 1470 CDS 100% 5.625 4.500 N Klf12 n/a
5 TRCN0000226309 ACTAGAGAATCAGCTTATAAT pLKO_005 5974 3UTR 100% 15.000 10.500 N Klf12 n/a
6 TRCN0000096404 CCCAGCTTTCTGTGGCAAATT pLKO.1 3517 3UTR 100% 13.200 9.240 N Klf12 n/a
7 TRCN0000096405 CCGAGGAAATCGAATGAATAA pLKO.1 1472 CDS 100% 13.200 9.240 N Klf12 n/a
8 TRCN0000226307 GTATCCAGGGTCCGAGGAAAT pLKO_005 1461 CDS 100% 10.800 7.560 N Klf12 n/a
9 TRCN0000218857 TGAACTTACAGTCTAACAAAC pLKO_005 1156 CDS 100% 10.800 7.560 N Klf12 n/a
10 TRCN0000096407 CCAGCAGTTCTTGCACATCAT pLKO.1 1109 CDS 100% 4.950 3.465 N Klf12 n/a
11 TRCN0000096406 GCCCTTGAGAACAGAATGCTA pLKO.1 527 5UTR 100% 3.000 2.100 N Klf12 n/a
12 TRCN0000015804 GCGTTAATGAAACTGGATCTA pLKO.1 1393 CDS 100% 4.950 3.960 N KLF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07793 pDONR223 100% 79.1% 85.8% None (many diffs) n/a
2 ccsbBroad304_07793 pLX_304 0% 79.1% 85.8% V5 (many diffs) n/a
3 TRCN0000470107 GAAATTCAATCTAGGGCCCATTTG pLX_317 36.6% 79.1% 85.8% V5 (many diffs) n/a
Download CSV