Transcript: Mouse XM_017315957.1

PREDICTED: Mus musculus ubiquitin-conjugating enzyme E2E 2 (Ube2e2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ube2e2 (218793)
Length:
1708
CDS:
282..977

Additional Resources:

NCBI RefSeq record:
XM_017315957.1
NBCI Gene record:
Ube2e2 (218793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040960 GACCCAAAGGAGACAACATTT pLKO.1 604 CDS 100% 13.200 10.560 N Ube2e2 n/a
2 TRCN0000040962 CGAGAATCTATCACTGTAATA pLKO.1 745 CDS 100% 13.200 9.240 N Ube2e2 n/a
3 TRCN0000040959 GAACAAGTTCAGCCTAAGAAA pLKO.1 453 CDS 100% 5.625 3.938 N Ube2e2 n/a
4 TRCN0000040961 CAAGCACTAGTGGAGGAAGTT pLKO.1 388 CDS 100% 0.000 0.000 N Ube2e2 n/a
5 TRCN0000040958 CCAATCAGAATCACTGTGCAT pLKO.1 1489 3UTR 100% 2.640 1.584 N Ube2e2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01737 pDONR223 100% 79.9% 86.5% None (many diffs) n/a
2 ccsbBroad304_01737 pLX_304 0% 79.9% 86.5% V5 (many diffs) n/a
3 TRCN0000491351 TATATGCCAGTGTTGGAGCAGTAC pLX_317 41.4% 79.9% 86.5% V5 (many diffs) n/a
Download CSV