Construct: ORF TRCN0000491351
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008613.2_s317c1
- Derived from:
- ccsbBroadEn_01737
- DNA Barcode:
- TATATGCCAGTGTTGGAGCAGTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UBE2E2 (7325)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491351
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | NM_001370225.1 | 100% | 100% | |
2 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | NM_152653.4 | 100% | 100% | |
3 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | NM_001370226.1 | 89.4% | 78.4% | (many diffs) |
4 | human | 10477 | UBE2E3 | ubiquitin conjugating enzym... | NM_001278554.1 | 76.8% | 85.9% | (many diffs) |
5 | human | 10477 | UBE2E3 | ubiquitin conjugating enzym... | NM_001278555.1 | 76.8% | 85.9% | (many diffs) |
6 | human | 10477 | UBE2E3 | ubiquitin conjugating enzym... | NM_006357.4 | 76.8% | 85.9% | (many diffs) |
7 | human | 10477 | UBE2E3 | ubiquitin conjugating enzym... | NM_182678.2 | 76.8% | 85.9% | (many diffs) |
8 | human | 10477 | UBE2E3 | ubiquitin conjugating enzym... | XM_005246244.2 | 76.8% | 85.9% | (many diffs) |
9 | human | 7324 | UBE2E1 | ubiquitin conjugating enzym... | NM_001202476.2 | 65.2% | 71.1% | (many diffs) |
10 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | NM_001370227.1 | 37.6% | 37.3% | 228_228delGins376 |
11 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | NM_001370228.1 | 37.6% | 37.3% | 228_228delGins376 |
12 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | XM_017007126.1 | 36.3% | 14.7% | (many diffs) |
13 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | XR_001740249.2 | 34.4% | 1_264del;492_622del;999_1750del | |
14 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | XM_011534075.1 | 28% | 5.5% | (many diffs) |
15 | human | 7325 | UBE2E2 | ubiquitin conjugating enzym... | XM_011534076.3 | 27.4% | 12.1% | 1_227del;454delG;456_457ins375 |
16 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | NM_144839.1 | 91.8% | 99.5% | (many diffs) |
17 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_006518013.1 | 91.8% | 99.5% | (many diffs) |
18 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_006518012.2 | 89.2% | 96.6% | (many diffs) |
19 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_017315958.1 | 85.8% | 93% | (many diffs) |
20 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_017315960.1 | 85.8% | 93% | (many diffs) |
21 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_006518010.2 | 82% | 88.8% | (many diffs) |
22 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_017315957.1 | 79.9% | 86.5% | (many diffs) |
23 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_017315956.1 | 77.2% | 83.6% | (many diffs) |
24 | mouse | 22193 | Ube2e3 | ubiquitin-conjugating enzym... | NM_009454.2 | 77.1% | 85.9% | (many diffs) |
25 | mouse | 22193 | Ube2e3 | ubiquitin-conjugating enzym... | XM_006499161.3 | 77.1% | 85.9% | (many diffs) |
26 | mouse | 22193 | Ube2e3 | ubiquitin-conjugating enzym... | XM_006499162.3 | 77.1% | 85.9% | (many diffs) |
27 | mouse | 22193 | Ube2e3 | ubiquitin-conjugating enzym... | XM_006499163.3 | 77.1% | 85.9% | (many diffs) |
28 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_017315959.1 | 75.2% | 81.3% | (many diffs) |
29 | mouse | 218793 | Ube2e2 | ubiquitin-conjugating enzym... | XM_011244758.2 | 70.4% | 60.3% | (many diffs) |
30 | mouse | 22194 | Ube2e1 | ubiquitin-conjugating enzym... | XM_011244759.1 | 62.7% | 70.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 669
- ORF length:
- 603
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cactgaggca caaagagttg atgacagtcc aagcactagt ggaggaagtt 121 ccgatggaga tcaacgtgaa agtgttcagc aagaaccaga aagagaacaa gttcagccca 181 agaaaaagga gggaaaaata tccagcaaaa ccgctgctaa attgtcaact agtgctaaaa 241 gaattcagaa ggaacttgca gaaatcacat tggaccctcc tcccaactgt agtgctggac 301 ccaaaggaga caacatttat gaatggaggt caactatatt gggaccccca ggatctgtct 361 atgaaggagg ggtgttcttt cttgacatta ccttttcacc agactatccg tttaaacccc 421 cTAAGGTTAC CTTCCGAACA AGAATCTATC ACTGTAATAT TAACAGCCAA GGTGTGATCT 481 GTCTGGACAT CTTAAAGGAC AACTGGAGTC CGGCTTTAAC TATTTCTAAA GTTCTCCTCT 541 CCATCTGCTC ACTTCTTACA GATTGCAACC CTGCTGACCC TCTGGTGGGC AGCATCGCCA 601 CACAGTACAT GACCAACAGA GCAGAGCATG ACCGGATGGC CAGACAGTGG ACCAAGCGGT 661 ACGCCACATA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 721 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 781 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATATATG CCAGTGTTGG AGCAGTACAC 841 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt