Transcript: Mouse XM_017316017.1

PREDICTED: Mus musculus family with sequence similarity 160, member B2 (Fam160b2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam160b2 (239170)
Length:
3592
CDS:
479..1840

Additional Resources:

NCBI RefSeq record:
XM_017316017.1
NBCI Gene record:
Fam160b2 (239170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376234 AGCAGTGACGGAGATTGTTAA pLKO_005 1201 CDS 100% 13.200 10.560 N Fam160b2 n/a
2 TRCN0000367149 CAGAGCTGCTGGCCTATATTC pLKO_005 199 5UTR 100% 13.200 9.240 N Fam160b2 n/a
3 TRCN0000367081 GTGACTATCTCTGCTATATTG pLKO_005 2090 3UTR 100% 13.200 9.240 N Fam160b2 n/a
4 TRCN0000377235 TTGCCACGCTGAGGCTATTTG pLKO_005 957 CDS 100% 13.200 9.240 N Fam160b2 n/a
5 TRCN0000376233 TCCTGGAGGAGAATGGATATG pLKO_005 1266 CDS 100% 10.800 7.560 N Fam160b2 n/a
6 TRCN0000376172 CCAGCAGACATTGCCACTTTA pLKO_005 536 CDS 100% 13.200 7.920 N Fam160b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12482 pDONR223 100% 63.7% 65.7% None (many diffs) n/a
2 ccsbBroad304_12482 pLX_304 0% 63.7% 65.7% V5 (many diffs) n/a
3 TRCN0000466274 GCACAGGACATCCCGTTACCTTTA pLX_317 34.3% 63.7% 65.7% V5 (many diffs) n/a
Download CSV