Transcript: Mouse XM_017316177.1

PREDICTED: Mus musculus calcium binding protein 39-like (Cab39l), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cab39l (69008)
Length:
2637
CDS:
312..1265

Additional Resources:

NCBI RefSeq record:
XM_017316177.1
NBCI Gene record:
Cab39l (69008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110691 CGAGAAGAACTACCTGATTAA pLKO.1 1211 CDS 100% 13.200 18.480 N Cab39l n/a
2 TRCN0000332115 CGAGAAGAACTACCTGATTAA pLKO_005 1211 CDS 100% 13.200 18.480 N Cab39l n/a
3 TRCN0000110690 GCCGACTATCAGTGTCTTCAA pLKO.1 2144 3UTR 100% 4.950 3.960 N Cab39l n/a
4 TRCN0000110694 CACCATTATGACCAAGTATAT pLKO.1 977 CDS 100% 13.200 9.240 N Cab39l n/a
5 TRCN0000332045 CACCATTATGACCAAGTATAT pLKO_005 977 CDS 100% 13.200 9.240 N Cab39l n/a
6 TRCN0000110693 ACCGCCACAATTTCACCATTA pLKO.1 964 CDS 100% 10.800 7.560 N Cab39l n/a
7 TRCN0000332044 ACCGCCACAATTTCACCATTA pLKO_005 964 CDS 100% 10.800 7.560 N Cab39l n/a
8 TRCN0000110692 CCTCACATCCTGTTTATGCTT pLKO.1 678 CDS 100% 3.000 2.100 N Cab39l n/a
9 TRCN0000332114 CCTCACATCCTGTTTATGCTT pLKO_005 678 CDS 100% 3.000 2.100 N Cab39l n/a
10 TRCN0000044248 CAGCCCAAACTCATTGAGTTT pLKO.1 1143 CDS 100% 0.495 0.347 N CAB39L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09077 pDONR223 100% 84.9% 92.2% None (many diffs) n/a
2 ccsbBroad304_09077 pLX_304 0% 84.9% 92.2% V5 (many diffs) n/a
Download CSV