Transcript: Mouse XM_017316290.1

PREDICTED: Mus musculus outer dense fiber of sperm tails 2 (Odf2), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Odf2 (18286)
Length:
4163
CDS:
598..3078

Additional Resources:

NCBI RefSeq record:
XM_017316290.1
NBCI Gene record:
Odf2 (18286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247776 CTCATAAGCGCGGAATGAAAG pLKO_005 710 CDS 100% 10.800 15.120 N Odf2 n/a
2 TRCN0000247772 CCTTACATGTTCACGTGGATG pLKO_005 623 CDS 100% 4.050 5.670 N Odf2 n/a
3 TRCN0000247774 CAGCAGCCAGAAATCTCATAA pLKO_005 696 CDS 100% 13.200 10.560 N Odf2 n/a
4 TRCN0000247775 CTCCTGTCCACGTCCACATAA pLKO_005 650 CDS 100% 13.200 10.560 N Odf2 n/a
5 TRCN0000247773 GTGGGAGAATCCACCTCATTG pLKO_005 825 CDS 100% 10.800 7.560 N Odf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11008 pDONR223 100% 83.5% 89.9% None (many diffs) n/a
2 ccsbBroad304_11008 pLX_304 0% 83.5% 89.9% V5 (many diffs) n/a
3 TRCN0000465232 CTCGCCGGGAATAAGATTTCCTCC pLX_317 14.7% 83.5% 89.9% V5 (many diffs) n/a
Download CSV