Transcript: Mouse XM_017316540.1

PREDICTED: Mus musculus transcription factor CP2 (Tfcp2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfcp2 (21422)
Length:
3260
CDS:
145..1650

Additional Resources:

NCBI RefSeq record:
XM_017316540.1
NBCI Gene record:
Tfcp2 (21422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218787 CAGGATTCTCGACATAGATAT pLKO_005 585 CDS 100% 13.200 18.480 N Tfcp2 n/a
2 TRCN0000225943 GCGGCCAAGGCTAACCATTTA pLKO_005 1302 CDS 100% 13.200 18.480 N Tfcp2 n/a
3 TRCN0000085493 CCCTGTTGATACCAGTAAGAA pLKO.1 1883 3UTR 100% 5.625 7.875 N Tfcp2 n/a
4 TRCN0000085494 CCCGATAATGAGAACGAGATT pLKO.1 316 CDS 100% 4.950 6.930 N Tfcp2 n/a
5 TRCN0000085495 CCTTCTTATGAGACAACCATA pLKO.1 943 CDS 100% 4.950 6.930 N Tfcp2 n/a
6 TRCN0000257281 CCGATAATGAGAACGAGATTC pLKO_005 317 CDS 100% 10.800 8.640 N Tfcp2 n/a
7 TRCN0000218063 AGATCACCTACGTCAACAATT pLKO_005 989 CDS 100% 13.200 9.240 N Tfcp2 n/a
8 TRCN0000225944 CCTTACCACTGTAGCGATAAT pLKO_005 2597 3UTR 100% 13.200 9.240 N Tfcp2 n/a
9 TRCN0000085497 GCAGATGGAATCAGACTCTTT pLKO.1 1258 CDS 100% 4.950 3.465 N Tfcp2 n/a
10 TRCN0000085496 CCTGCTTTATTCTGGACACGA pLKO.1 1589 CDS 100% 2.640 1.848 N Tfcp2 n/a
11 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 3054 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01661 pDONR223 100% 88.1% 96.4% None (many diffs) n/a
2 ccsbBroad304_01661 pLX_304 0% 88.1% 96.4% V5 (many diffs) n/a
3 TRCN0000470554 TTTCGACTACCGCGCAAACTAGCT pLX_317 30.2% 88.1% 96.4% V5 (many diffs) n/a
Download CSV