Transcript: Mouse XM_017316619.1

PREDICTED: Mus musculus cysteine sulfinic acid decarboxylase (Csad), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csad (246277)
Length:
2354
CDS:
93..1595

Additional Resources:

NCBI RefSeq record:
XM_017316619.1
NBCI Gene record:
Csad (246277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106641 CCGGTTCTTCAACCAGCTCTT pLKO.1 353 CDS 100% 4.050 5.670 N Csad n/a
2 TRCN0000327564 CCGGTTCTTCAACCAGCTCTT pLKO_005 353 CDS 100% 4.050 5.670 N Csad n/a
3 TRCN0000106642 CAGGCCGATATAGATTTCCTT pLKO.1 1682 3UTR 100% 3.000 4.200 N Csad n/a
4 TRCN0000311598 GGATGCAATTGCCGATGTTTG pLKO_005 860 CDS 100% 10.800 8.640 N Csad n/a
5 TRCN0000306695 TACTTGGTGGAGGAGATTAAA pLKO_005 1260 CDS 100% 15.000 10.500 N Csad n/a
6 TRCN0000106640 GCTGGATATGAGTTTATGAAT pLKO.1 2134 3UTR 100% 5.625 3.938 N Csad n/a
7 TRCN0000327499 GCTGGATATGAGTTTATGAAT pLKO_005 2134 3UTR 100% 5.625 3.938 N Csad n/a
8 TRCN0000106643 GCAAGACAAGTTCTACGATGT pLKO.1 1106 CDS 100% 4.050 2.835 N Csad n/a
9 TRCN0000106644 CAGCAAGACAAGTTCTACGAT pLKO.1 1104 CDS 100% 3.000 2.100 N Csad n/a
10 TRCN0000327565 CAGCAAGACAAGTTCTACGAT pLKO_005 1104 CDS 100% 3.000 2.100 N Csad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11984 pDONR223 100% 72.3% 70.5% None (many diffs) n/a
2 ccsbBroad304_11984 pLX_304 0% 72.3% 70.5% V5 (many diffs) n/a
3 TRCN0000468049 AACTATATTATAACGATGATTTGT pLX_317 15.2% 72.3% 70.5% V5 (many diffs) n/a
Download CSV