Construct: ORF TRCN0000468049
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014253.1_s317c1
- Derived from:
- ccsbBroadEn_11984
- DNA Barcode:
- AACTATATTATAACGATGATTTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CSAD (51380)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468049
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51380 | CSAD | cysteine sulfinic acid deca... | NM_001244705.2 | 100% | 100% | |
2 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_024449014.1 | 100% | 100% | |
3 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_024449015.1 | 100% | 100% | |
4 | human | 51380 | CSAD | cysteine sulfinic acid deca... | NM_015989.5 | 94.8% | 94.8% | 1_81del |
5 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_011538446.3 | 94.8% | 94.8% | 1_81del |
6 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_024449013.1 | 94% | 87.2% | 568_620del;756_795del |
7 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_011538442.2 | 89.4% | 82.9% | 1_81del;649_701del;837_876del |
8 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_024449012.1 | 83.7% | 83.7% | 1_288del |
9 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_024449011.1 | 79.5% | 73.7% | 1_288del;856_908del;1044_1083del |
10 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_017019416.2 | 74.6% | 65.6% | (many diffs) |
11 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_017019419.1 | 64.3% | 57.4% | 0_1ins468;100_152del;288_327del |
12 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_011538451.1 | 55.7% | 55.7% | 0_1ins654 |
13 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_017019418.1 | 55.7% | 55.7% | 0_1ins654 |
14 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_011538449.1 | 55.2% | 53.7% | 0_1ins640;63_102del |
15 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XM_017019417.1 | 55.2% | 53.7% | 0_1ins640;63_102del |
16 | human | 51380 | CSAD | cysteine sulfinic acid deca... | NM_001244706.1 | 52.6% | 52.5% | 0_1ins700;2delT |
17 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XR_002957335.1 | 51.8% | 1_484del;1187_1226del;2004_2854del | |
18 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XR_001748742.2 | 51.5% | 1_484del;1052_1104del;2017_2867del | |
19 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XR_001748745.2 | 50.2% | 1_483del;1302_1303ins65;1898_2748del | |
20 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XR_002957336.1 | 49.5% | (many diffs) | |
21 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XR_001748743.2 | 49.3% | (many diffs) | |
22 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XR_001748744.2 | 48.5% | (many diffs) | |
23 | human | 51380 | CSAD | cysteine sulfinic acid deca... | XR_944571.3 | 41.1% | (many diffs) | |
24 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | NM_144942.4 | 88.2% | 89.6% | (many diffs) |
25 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_006520999.3 | 88.2% | 89.6% | (many diffs) |
26 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_011245638.1 | 83.1% | 84.3% | (many diffs) |
27 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_011245642.1 | 77.3% | 70.6% | (many diffs) |
28 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_011245643.2 | 72.4% | 72% | (many diffs) |
29 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316620.1 | 72.4% | 72% | (many diffs) |
30 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316612.1 | 72.3% | 70.5% | (many diffs) |
31 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316613.1 | 72.3% | 70.5% | (many diffs) |
32 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316614.1 | 72.3% | 70.5% | (many diffs) |
33 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316615.1 | 72.3% | 70.5% | (many diffs) |
34 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316616.1 | 72.3% | 70.5% | (many diffs) |
35 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316617.1 | 72.3% | 70.5% | (many diffs) |
36 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316618.1 | 72.3% | 70.5% | (many diffs) |
37 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XM_017316619.1 | 72.3% | 70.5% | (many diffs) |
38 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XR_001781534.1 | 56.8% | (many diffs) | |
39 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XR_001781535.1 | 53.4% | (many diffs) | |
40 | mouse | 246277 | Csad | cysteine sulfinic acid deca... | XR_001781536.1 | 51.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1548
- ORF length:
- 1479
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgactca gaagcactcc cctcccttgc tggggaccca gtggctgtgg 121 aagccttgct ccgggccgtg tttggggttg ttgtggatga ggccattcag aaaggaacca 181 gtgtctccca gaaggtctgt gagtggaagg agcctgagga gctgaagcag ctgctggatt 241 tggagctgcg gagccagggc gagtcacaga agcagatcct ggagcggtgt cgggctgtga 301 ttcgctacag tgtcaagact ggtcaccctc ggttcttcaa ccagctcttc tctgggttgg 361 atccccatgc tctggccggg cgcattatca ctgagagcct caacaccagc cagtacacat 421 atgaaatcgc ccccgtgttt gtgctcatgg aagaggaggt gctgaggaaa ctgcgggccc 481 tggtgggctg gagctctggg gacggaatct tctgccctgg tggctccatc tccaacatgt 541 atgctgtaaa tctggcccgc tatcagcgct acccggattg caagcagagg ggcctccgca 601 cactgccgcc cctggcccta ttcacatcga aggagtgtca ctactccatc cagaagggag 661 ctgcgtttct gggacttggc accgacagtg tccgagtggt caaggctgat gagagaggga 721 aaatggtccc cgaggatctg gagaggcaga ttggtatggc cgaggctgag ggtgctgtgc 781 cgttcctggt cagtgccacc tctggcacca ctgtgctagg ggcctttgac cccctggagg 841 caattgctga tgtgtgccag cgtcatgggc tatggctgca tgtggatgct gcctggggtg 901 ggagcgtcct gctgtcacag acacacaggc atctcctgga tgggatccag agggctgact 961 ctgtggcctg gaatccccac aagctcctcg cagcaggcct gcaatgctct gcacttcttc 1021 tccaggatac ctcgaacctg ctcaagcgct gccatgggtc ccaggccagc taccttttcc 1081 agcaggacaa gttctacgat gtggctctgg acacgggaga caaggtggtg cagtgtggcc 1141 gccgtgtgga ctgtctgaag ctgtggctca tgtggaaggc acagggcgat caagggctgg 1201 agcggcgcat cgaccaggcc tttgtccttg cccggtacct ggtggaggaa atgaagaagc 1261 gggaagggtt tgagctagtc atggagcctg agtttgtcaa tgtgtgtttc tggttcgtac 1321 cccccagccT GCGAGGGAAG CAGGAGAGTC CAGATTACCA CGAAAGGCTG TCAAAGGTGG 1381 CCCCCGTGCT CAAGGAGCGC ATGGTGAAGG AGGGCTCCAT GATGATTGGC TACCAGCCCC 1441 ACGGGACCCG GGGCAACTTC TTCCGTGTGG TTGTGGCCAA CTCTGCACTG ACCTGTGCTG 1501 ATATGGACTT CCTCCTCAAC GAGCTGGAGC GGCTAGGCCA GGACCTGTTG CCAACTTTCT 1561 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1621 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1681 GTGGAAAGGA CGAAACTATA TTATAACGAT GATTTGTACG CGTTAAGTCg acaatcaacc 1741 tctggattac aaaatttgtg aaagatt