Transcript: Mouse XM_017316758.1

PREDICTED: Mus musculus synaptosomal-associated protein 25 (Snap25), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snap25 (20614)
Length:
2157
CDS:
258..878

Additional Resources:

NCBI RefSeq record:
XM_017316758.1
NBCI Gene record:
Snap25 (20614)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381464 TTCATCCGCAGGGTAACAAAT pLKO_005 654 CDS 100% 13.200 18.480 N SNAP25 n/a
2 TRCN0000348198 GATGCTGGGAAGTGGTTAAAT pLKO_005 860 CDS 100% 15.000 10.500 N Snap25 n/a
3 TRCN0000348199 CATGCTTCTCTCATGGTATTA pLKO_005 933 3UTR 100% 13.200 9.240 N Snap25 n/a
4 TRCN0000348200 CATCGGAAACCTCCGCCATAT pLKO_005 725 CDS 100% 10.800 7.560 N Snap25 n/a
5 TRCN0000110592 CATCAGGACTTTGGTTATGTT pLKO.1 386 CDS 100% 5.625 3.938 N Snap25 n/a
6 TRCN0000334139 CATCAGGACTTTGGTTATGTT pLKO_005 386 CDS 100% 5.625 3.938 N Snap25 n/a
7 TRCN0000156232 CCAACCAACGTGCAACAAAGA pLKO.1 841 CDS 100% 4.950 3.465 N SNAP25 n/a
8 TRCN0000343626 CCAACCAACGTGCAACAAAGA pLKO_005 841 CDS 100% 4.950 3.465 N SNAP25 n/a
9 TRCN0000110593 GCAATGAGATTGACACCCAGA pLKO.1 760 CDS 100% 2.160 1.512 N Snap25 n/a
10 TRCN0000110594 AGAATTGATGAAGCCAACCAA pLKO.1 828 CDS 100% 3.000 1.800 N Snap25 n/a
11 TRCN0000334071 AGAATTGATGAAGCCAACCAA pLKO_005 828 CDS 100% 3.000 1.800 N Snap25 n/a
12 TRCN0000110591 TGGACCAAATCAATAAGGATA pLKO.1 448 CDS 100% 4.950 3.465 N Snap25 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 974 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.