Transcript: Mouse XM_017316787.1

PREDICTED: Mus musculus ring finger protein 139 (Rnf139), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf139 (75841)
Length:
2501
CDS:
484..2250

Additional Resources:

NCBI RefSeq record:
XM_017316787.1
NBCI Gene record:
Rnf139 (75841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041136 CGGGCAATATTATCGAATTTA pLKO.1 1643 CDS 100% 15.000 21.000 N Rnf139 n/a
2 TRCN0000446718 ATGATTGATGGCTACTATAAC pLKO_005 1576 CDS 100% 13.200 10.560 N Rnf139 n/a
3 TRCN0000041133 CGTCCTTGATTCTCATATTTA pLKO.1 788 CDS 100% 15.000 10.500 N Rnf139 n/a
4 TRCN0000440035 TGTGATGTGCTACTGTAAATA pLKO_005 2385 3UTR 100% 15.000 10.500 N Rnf139 n/a
5 TRCN0000443424 ATATCTTGGTTCCTATAATTG pLKO_005 716 CDS 100% 13.200 9.240 N Rnf139 n/a
6 TRCN0000441646 GGTATAGTTGTATCCAGTATT pLKO_005 424 5UTR 100% 13.200 9.240 N Rnf139 n/a
7 TRCN0000441718 ATGCACTCTGCCTTCGGAAAT pLKO_005 1946 CDS 100% 10.800 7.560 N Rnf139 n/a
8 TRCN0000453190 ATGTCCTTTGGCATCACTATG pLKO_005 1466 CDS 100% 10.800 7.560 N Rnf139 n/a
9 TRCN0000041134 GCATCTAACAACAACGGATTT pLKO.1 2044 CDS 100% 10.800 7.560 N Rnf139 n/a
10 TRCN0000041137 CCTTTCTATTAGCTGCAACTT pLKO.1 497 CDS 100% 4.950 3.465 N Rnf139 n/a
11 TRCN0000439779 GGACGTCATTTGCAATCTAAT pLKO_005 1065 CDS 100% 13.200 7.920 N Rnf139 n/a
12 TRCN0000293968 ATGATTGATGGCTACTATAAT pLKO_005 1576 CDS 100% 15.000 12.000 N RNF139 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07782 pDONR223 100% 79.9% 82.1% None (many diffs) n/a
2 ccsbBroad304_07782 pLX_304 0% 79.9% 82.1% V5 (many diffs) n/a
3 TRCN0000474106 ACGGAGATCACGGACCGCGCGCGC pLX_317 17.7% 79.9% 82.1% V5 (many diffs) n/a
Download CSV