Transcript: Mouse XM_017316943.1

PREDICTED: Mus musculus uroplakin 1B (Upk1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Upk1b (22268)
Length:
1823
CDS:
128..910

Additional Resources:

NCBI RefSeq record:
XM_017316943.1
NBCI Gene record:
Upk1b (22268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249763 GTACTTACGTGTACTATATAA pLKO_005 1187 3UTR 100% 15.000 21.000 N Upk1b n/a
2 TRCN0000194016 GCCTAAGATTCCGAAATGTAT pLKO.1 1115 3UTR 100% 5.625 7.875 N Upk1b n/a
3 TRCN0000216264 CTAGCCATAGTAGGAATTATG pLKO.1 350 CDS 100% 13.200 10.560 N Upk1b n/a
4 TRCN0000249762 TCTAGCCATAGTAGGAATTAT pLKO_005 349 CDS 100% 15.000 10.500 N Upk1b n/a
5 TRCN0000249761 CGTACTTCATCATGATGTTTA pLKO_005 396 CDS 100% 13.200 9.240 N Upk1b n/a
6 TRCN0000249764 TGCGTCATGGACAAGCTTAAA pLKO_005 698 CDS 100% 13.200 9.240 N Upk1b n/a
7 TRCN0000193384 CAGAGTGTATCTTCTTTGTAT pLKO.1 219 CDS 100% 5.625 3.938 N Upk1b n/a
8 TRCN0000194521 GACAGCAGAGTGTATCTTCTT pLKO.1 214 CDS 100% 4.950 3.465 N Upk1b n/a
9 TRCN0000138431 CCATGTTCTACTGGAGCAGAA pLKO.1 879 CDS 100% 4.050 2.835 N UPK1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07116 pDONR223 100% 87.5% 91.1% None (many diffs) n/a
Download CSV