Transcript: Mouse XM_017317113.1

PREDICTED: Mus musculus presequence translocase-asssociated motor 16 homolog (S. cerevisiae) (Pam16), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pam16 (66449)
Length:
652
CDS:
16..570

Additional Resources:

NCBI RefSeq record:
XM_017317113.1
NBCI Gene record:
Pam16 (66449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194181 GAGGTCCAGAAGAATTATGAA pLKO.1 406 CDS 100% 5.625 3.938 N Pam16 n/a
2 TRCN0000173123 CTCTTTCTACCTGCAGTCAAA pLKO.1 462 CDS 100% 4.950 3.465 N Pam16 n/a
3 TRCN0000175674 GTCCAGAAGAATTATGAACAC pLKO.1 409 CDS 100% 4.050 2.835 N Pam16 n/a
4 TRCN0000193317 CAGAAGAATTATGAACACCTA pLKO.1 412 CDS 100% 2.640 1.848 N Pam16 n/a
5 TRCN0000176322 CCAGAAGAATTATGAACACCT pLKO.1 411 CDS 100% 2.640 1.848 N Pam16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03178 pDONR223 100% 60% 64.6% None (many diffs) n/a
2 ccsbBroad304_03178 pLX_304 0% 60% 64.6% V5 (many diffs) n/a
3 TRCN0000465312 ACGATTGTTGGAAAAATCTGAGGT pLX_317 57.2% 60% 64.6% V5 (many diffs) n/a
Download CSV